نمونه سوالات دوم و سوم دبیرستان و ...

سلام دوستان عزیز

اگه میبینید این وبلاگ ۳ سال آپ نشده دلیلش اینه که من دیگه نمیومدم اینجا.

این وبو وقتی مینوشتم که دبیرستان میرفتم.الان دانشجوی سال ۲پزشکی هستم.

متاسفانه دیگه نمیتونم مطلب بزارم از کسایی که نظر گذاشتن ممنونم.

امیدوارم از مطالب استفاده کرده باشین.

با آرزوی موفقیت برای همگی خدانگهدار

+ نوشته شده در  شنبه 1389/05/30ساعت 1:24  توسط مینا  | 

نمونه سوال زمین شناسی سوم فصل 7

۱.رسوبات به وسیله چه عواملی به وجود می آیند و به چه شکلی ته نشین می شود؟

۲.چند درصد پوسته زمین و چقدر از سطح زمین را سنگ های رسوبی تشکیل می دهند؟

۳.فروانترین سنگ های رسوبی سطح زمین را با ذکر درصد بنویسید؟

۴.مواد تخریب شده شامل چه سنگ هایی هستند؟

۵.با مثال طرز تشکیل مواد شیمیایی را در آبها توضیح دهید؟

۶.کانی کوارتز که بیش تر حجم ماسه سنگ ها را تشکیل می دهد چگونه به وجود می آید؟

۷.کانی اوپال چگونه تشکیل می شود؟

۸.طرز تشکیل سنگ فلینت و کلسدون را بنویسید؟

۹.دیاژنز چیست؟انواع آن را نام ببرید؟

۱۰.اندازه دانه هایی که به محیط های رسوبی برده می شود به چه عواملی بستگی دارد؟

+ نوشته شده در  جمعه 1386/01/24ساعت 15:53  توسط مینا  | 

نمونه سوالات ادبیات سال سوم تجربی و ریاضی

نمونه سوالات ادبیات سال سوم تجربی و ریاضی

 

1.معنی کدام کلمه نا درست است؟(آزاد68)

1)خضرت:سبزی         2)صفوت:روشن            3)قسیم:صاحب جمال          4)سقیم:نادرست

 

2)در این بیت  رقیب چه معنی می دهد؟ ایزد که رقیب جان خرد کرد/ نام تو ردیف  نام خود کرد(سراسری 65)

1)دشمن                   2)حریف                  3)عاشق                 4)نگهبان

 

3)معانی درست  همه ی کلمه های انابه- ینبوع – متنبه – سطوت  به ترتیب کدام است؟(سراسری83)

1)توبه-جنگل-عابد-تندی                  2)پشیمانی-کوه-هوشیار-غلبه

3)غرور-دریا-بیزار-وقار                  4)بازگشت- چشمه-آگاه-حشمت

 

4)مفهوم عبارت (وظیفه ی روزی به خطای منکر نبرد) از کدام گزینه دریافت نمی شود؟(سراسری83)

1)زبانم را ثنای خود در آموز           2)کرم های تو ما را گستاخ

3)عذر پذیرنده ی تقصیرها               4)روز بر آرنده ی روزی خوران

 

5)با توجه به معنی املای کدام واژه درست است؟(آزاد 83)

1)فصحت – گشادی خاطر                        2)کنّاص- رفتگر

3)عزلت-گوشه نشینی                              4)سله- جایزه

 

6)در بیت ز نیروی گردان و زخم سران/شکسته شد آن تیغ های گران معنای ((زخم)) چیست؟(سراسری75)

1)جراحت              2)ضربت                    3)شکستگی               4)رنج

 

7)معنای کدام کلمه نادرست است؟(سراسری81)

1)برگستوان:لباس جنگی            2)دوال:لگام مخملی مزیّن به زر و سیم

3)فتراک:ترک بند                     4)گبر:نوعی زره و لباس جنگی

 

8)در مصراع نجنبید یک شیر بر پشت زین از چه آرایه ای استفاده شده است؟(آزاد 83)

1)اغراق               2)حسّ امیزی           3)کنایه                   4)استعاره

 

9)پیوستگی منظم اعمال و حوادث داستان که مبتنی داستان که میتنی بر رابطه علت و معلولی است چه نامیده می شود؟(سراسری 80)

1)درون مایه                2)زاویه دید         3)لحن و سبک               4)هسته

 

10)غلامحسین ساعدی در کدام  نوع ادبیات آثاری از خود به جای گذاشته است؟(آزاد83)

1)پایداری          2)عرفانی                       3)حماسی            4)داستانی

+ نوشته شده در  پنجشنبه 1385/09/09ساعت 12:9  توسط مینا  | 

نمونه سوال زبان

Part A : Grammar

 

76- ……………. the weather is often warm , many of the homes have swimming pools .

    1) As                              2) Whether                   3) While                        4) When

 

77- I won't ever let him ……….. late for the class .

    1) be                              2) is                               3) to be                          4) being

 

78- He doesn't make me ………. 

    1) permit you stay here .                                                                           2) to permit you stay here .

    3) to permit you to stay here .                            4) permit you to stay here .

 

79- I stood under a tree ……….. it began to rain .

    1)  since                         2) when                         3) while                         4) however

 

 

80- Which sentence is grammatically wrong ?

    1)  Reza passed the exam by studying hard .

    2) The teacher forced all the students to read the book .

    3) Some people change their habit as they get older .

    4) Since we arrived at the party , she was cutting the cake .

 

 

Part B : Vocabulary

 

81- What this company needs is ………. management to be successful .

    1)  emotionless              2) ignorant                    3) firm                           4) attractive

 

82- The report ………. the importance of improving safety standards .

    1) emphasizes                2) stretches                  3) disturbs                     4) respects

 

83- The opening scene of dark , rainy streets shows the ………… of the whole film .

    1)  stance                       2) mood                         3) posture                     4) gesture

 

84- News of the war was used to …….. attention from other important social matters .

    1)  worry                        2) suppose                    3) distract                      4) react

 

85- The book is not intended for a completely academic ………. .

    1)  variety                      2) spectators                 3) viewers                     4) audience

 

86- The bed wasn't ………. , but I could sleep soon .

    1) comfortable               2) balanced                   3) facial                          4) confident

 

87- I am going to ask each of you to make a short ……… to explain the new idea .

    1)  difference                 2) presentation             3) decision                    4) effort

 

88- It is difficult to …….. the effectiveness of different education systems .

    1)  look                          2) include                      3) evaluate                    4) succeed

 

89- The cat escaped and managed to …… the top of the tree .

    1) lower                         2) bend                          3) lean                           4) climb

 

90- The new power station would ………. 1000 tons of carbon dioxide into the atmosphere each year .

    1)  protect                      2) increase                    3) release                      4) tap

 

91- When you make a short statement giving only the main information , you actually ………. .

    1)  summarize                2) realize                       3) repeat                       4) mention

 

Part C : Cloze passage

 

    When you are making a(n)…92…. , try to relax , speak slowly and clearly . Use simple …93… and expressions whenever possible .  …..94…. for a few seconds to give the people a chance to think about what you have said . Make ….95… that every one in the room can hear you . If the quality of voice ….96… is not good , you can use a microphone .

92-1)  amount                    2) waste                        3) speech                      4) trouble

 

93-1)  humor                      2) awareness                 3) accordance                4) vocabulary

 

94-1)  Continue                 2) Pause                        3) Hold                          4) Listen

 

95-1)  sure                         2) mistake                     3) occasion                    4) nervous

 

96-1)  contact                    2) communication         3) expression                4) projection

 

 

Part D : Reading comprehension

 

    There is no evidence that children receive less attention from mothers who work outside the home than from mothers working inside the home . You have to divide the time into different categories : simple physical and custodial function , and educational time or development time when a mother plays with the child so far we haven’t seen the amount of education time change much , whether or not the mother works outside the home .

    In fact , we have found evidence that working mothers -  specially in the middle class – try to compensate for their children and spend more time in planned activities with them than nonworking mothers do .

97- Which one is an example of "mothers custodial functions" ?

    1) To take care of babies so that they will physically improve .

    2) To play with children to help them develop mentally  .

    3) To take babies to kindergartens to learn basic skills .

    4) Not to go to work and spend all time at home .

 

 

98- According to the passage , It is true that ………

    1) working mothers easily forget their children .

    2) working mothers don't spend as much education time with their children as nonworking mothers .

    3) there is no evidence that children receive less attention from working mothers .

    4) the education time is the same as development time .

 

99- Which one is not mentioned ?

    1) The mothers divide their time into two parts .

    2) The amount of time to educate children doesn't change .

    3) Working mothers in comparision  to nonworking mothers .

    4) The reasons why mothers have to work outside the home .

100- How can the working mothers compensate for working ?

 

    1) By living in the middle class community .

    2) By planning physical and mental activities for their children .

    3) By setting aside more time for their children .

    4) They can never spend enough time on caring for their children .

منبع سایت گزینه ۲

+ نوشته شده در  شنبه 1385/07/15ساعت 12:59  توسط مینا  | 

نمونه سوال زبان انگلیسی

Grammar Part:

76 - You can still enjoy exercising …….. you are young or old.

     1) as                               2) whether                      3) since                           4) while

77 - ……… I felt really tired, I stayed at home and had a rest.

     1) As                              2) When                         3) Because of                 4) Whether

78 - I went to the beach ………. the weather was nice, but now I don’t have time to do that because I have to study.

     1) whether                      2) although                      3) when                          4) whereas

79 - Which sentence is grammatically wrong?

     1) since the weather was fine, we went out for a walk.

     2) Some people change their habits as they get older.

     3) I saw Peter since I was getting off the bus.

     4) When we arrived at the party, she was cutting the cake.

 

Vocabulary Part:

80 - Every time you eat food, your body does the same thing; it uses the …….. in it as fuel.

     1) calories                       2) chemicals                   3) cells                            4) nutrients

81 - Cut the meat into small pieces, each ……… about 100 grams.

     1) including                     2) weighing                     3) measuring                   4) handling

82 - She was so proud of her physical ……. that she had been able to lose weight.

     1) activity                       2) aerobics                      3) trouble                        4) breathe

83 - You can’t ……… the trains. they are always late.

     1) pick up                       2) get into                       3) depend on                   4) prevent from

84 - You have only one hour. You had better …….. your pen and start writing.

     1) look up                       2) climb up                      3) call up                         4) pick up

85 - I can’t believe that I am …….. going to university.

     1) deeply                        2) actually                       3) probably                      4) repetitively

86 - You could go there and back in a day …….. .

     1) increasing                   2) efficiently                   3) recently                      4) easily

87 - The doctor says to the patient, "No …… and lifting for at least three weeks."

     1) bending                       2) bothering                    3) creating                      4) releasing

88 - She …….. out her arm to take the book.

     1) stretched                    2) touched                      3) orbited                        4) rose

89 - It is the responsibility of the police to ……… us from the killers.

     1) prepare                       2) protect                        3) provide                       4) perform

90 - When we came home from our walk, we were tired but ……… .

     1) flexible                       2) extra                          3) happy                         4) serious

 

Cloze Test:

How long it takes you to become physically ..91.. relies ..92.. how unfit you are when you start exercising. If you are out of condition, you ..93.. can’t shape up in 21 days. ..94.., shaping up doesn’t do any good unless you plan to stay in shap, and that means exercising from now on. But the work won’t seem as hard after a while because your body will be in good condition - and all the moves will seem ..95.. .

91 - 1) hard working            2) fresh                          3) relaxed                       4) fit

92 - 1) in                             2) for                              3) on                               4) about

93 - 1) regularly                   2) certainly                     3) possibly                       4) briefly

94 - 1) furthermore              2) then                            3) since                           4) otherwise       

95 - 1) easy                         2) easily                          3) ease                           4) in an easy way

Reading Comprehension:

     There are several places in the world that are famous for people who live a very long time. these places are usually in mountanious areas, far away from modern cities. Men of ninety are fathers. They do physical work, have a clean environment and a simple diet high in vitamins but low in fat and sugar. The people not only live a long time, but they also live well. They are almost never sick, and when they die they have not only their own teeth but also good eyesight. The diets are similar in two general ways:1- The fruits and vegetables which are natural; that is, they contain no chemicals and 2- the people consume fewer calories than people  do in other parts of the world. these people are mostly farmers, their lives are physically hard, thus they do not need to go to health clubs. In addition, although their lives are hard, the people do not seem to have the worries of city people.

96 - What is the main topic of the passage?

      1) The secrets of a very long life                          2) The effects of physical activities on our lives

      3) The benefits of fruits and vegetables                 4) How to die while having one’s own teeth

97 - Which one is not stated as a reason of long life?

      1) Having good and healthful life- style                  2) Doing hard physical work

      3) Living in country side and quiet conditions         4) Consuming chemicals and vegetables

98 - The diets of people who live long is mostly …….

      1) high in calorie                                                  2) low in raw vegetable

      3) similar to general diets                                                                            4) low in fat and sugar

99 - Why does the writer think that the people in these places do not need to attend clubs?

      1) they do not live in cities                                    2) they do not have modern lives

      3) their lives consist of physical work                    4) they don’t worry much about the environment

100 - According to the passage, which one is not true?

         1) the less worried you are, the longer you can live

         2) As you have more simple diet, you are healthier

         3) Men living in cities can be fathers even in their nineties.

         4) places in which people live long are not rare.

 

 

 

 منبع سایت گزینه ۲

 

+ نوشته شده در  دوشنبه 1385/07/10ساعت 14:4  توسط مینا  | 

نمونه سوال ریاضی 2

نمونه سوال ریاضی 2
+ نوشته شده در  جمعه 1385/06/31ساعت 12:25  توسط مینا  | 

نمونه سوال ریاضی 2

نمونه سوال ریاضی 2
+ نوشته شده در  جمعه 1385/06/31ساعت 12:16  توسط مینا  | 

نمونه سوالات زیست دبیرستان و پیش

نمونه سوالات زیست دبیرستان و پیش

 

   

سوالات مشترک

 

141- رمز و ضد رمز آغاز ترجمه در تريكودينا به ترتيب توسط كدام آنزيم ساخته مي شوند ؟

     1( DNA پليمراز يوكاريوتي RNA پليمراز III                  2( RNA پليمراز II DNA پليمراز يوكاريوتي

     3(  RNAپليمراز پروكايوتي RNA پليمراز پروكاريوتي        4) RNA پليمراز II RNA پليمراز III

142- هرگاه در آزمايش نيرنبرگ فقط از دو نوع نوكلئوتيد آدنين دار و يوراسيل دار استفاده مي شد ، چند نوع رمز براي آمينو اسيدها پديد مي آمد ؟

     1) 6                                2) 7                                3) 8                                4) 9

143- در بيماري كم خوني داسي شكل ، كدام يك در حد ژن روي داده است ؟ (در این بیماری اسید آمینه
ی والین با کدون
GUG
جایگزین اسید آمینه
ی گلوتامیک اسید با کدون
GAG می
شود.)

     1) تبديل A به T                  2) تبديل A به U                 3) تبديل T به A                  4) تبديل U به A

144- مونومر فعال كننده و افزاينده به ترتيب كدامند ؟

     1) هر دو آمينو اسيد               2)‌ آمينو اسيد ، نوكلئوتيد          3) هر دو نوكلئوتيد                4) نوكلئوتيد ، آمينو اسيد

145- تنظيم بيان ژن در كدام جاندار ، بعد از ترجمه هم صورت مي گيرد ؟

     1) هموفيلوس آنفلوآنزا           2) استرپتوكوكوس نومونيا        3) اشرشيا كلاي                    4) نوروسپورا كراسا

146- هرگاه قطعه ژني در آدمي داراي 538 پيوند فسفو دي استر باشد ، رشته پلي پپتيدي كه تحت رهبري آن ساخته مي
شود
چند پيوند پپتيدي دارد ؟

     1) 90                              2) 89                              3) 88                               4) 87

147- كدام يك در هسته نورو گلياي آدمي داراي رمز است ؟

     1) لسيتين                           2) كوتين                           3) كراتين                           4) كيتين

148- هرگاه توالي يك رشته DNA به صورت CGTAATGCC باشد ، ملكول mRNA اي كه از روي رشته مقابل آن رونويسي مي
شود داراي چند باز پوريني است ؟

     1) 5                                2) 4                                3) 3                                4) 2

149- هرگاه ظرف شيري را به باكتري اشرشيا کلای آلوده كنيم ، احتمال تشكيل كدام تركيب بيشتر است ؟

     1) مهار كننده لاكتوز                                                 2) اپراتور مهار كننده

     3) پروتئين تنظيمي آلولاكتوز                                         4) RNA پليمراز اپراتور

150- tRNA آغازگر به ترتيب و از راست به چپ ، از كدام جايگاه وارد ريبوزوم شده و از كدام جايگاه خارج مي گردد ؟

     1) P , A                          2) A , P                          3) A , A                          4) P , P

151- عوامل رونويسي در آميب به كدام ، وصل نمي شوند ؟

     1) اپراتور                           2) توالي افزاينده                   3) RNA پليمراز                  4) راه انداز

152- در ترجمه RNA پيك مقابل ، اولين و آخرين آنتي كدوني كه درون جايگاه A ريبوزوم قرار مي گيرد به ترتيب و از راست به چپ كدامند ؟

CCUUUAAUGGCCUACGGCAUCGAUUAACCG

     1) AUU , AAU               2) CUA , CGG                3) AUU , CGG                4)‌ CUA , UAC

153- تنوع محصولاتِ كدام RNA پليمراز بيشتر است ؟

     1) I                                 2) III                              3) پروكاريوتي                     4) II

154- كپك نوروسپوراي غير جهش يافته قادر به ساختن كدام نمي باشد ؟

     1) فنيل اُرنیتین                     2) آرژینین                         3) بيوتين                           4) سيترولين

155- در پديده رونويسي ژن، كدام مرحله از بقیه زودتر انجام می
شود؟

     1) تشكيل پيوند هاي فسفودي استر                                   2) شكستن پيوند هاي هيدروژني

     3) اتصال هليكاز به DNA الگو                                       4) اتصال آنزيم RNAپليمراز به دو رشته DNA

 

156- اگر mRNA نابالغ در نوتروفیل داراي 3 توالي رونوشت اگزون باشد ، براي كوتاه شدن آن از راست به چپ چند پيوند فسفودي استر مي
شكند و تشكيل مي شود ؟

     1) 4 و 2                           2) 6 و 3                           3) 2 و 4                           4) 3 و 6

157- در انتهاي بخش رمز گردانِ ژن سازنده انواع RNA هاي ناقل کدام توالي ديده مي شود ؟

     1) CCA                          2) GGT                           3)‌ UAC                          4) GGU

158- جهش در كدام يك به نسل بعد هم منتقل مي گردد ؟

     1) كروموزم x در لوزالمعده      2) كروموزم y در كبد             3) كروموزم 21 در تخمك       4) كروموزم 23 در شبكيه

159- توالي راه انداز (P) داراي ....................... (جمله را کامل کنید)

     1) ريبوز بوده و رونويسي مي شود .                                  2) دئوكسي ريبوز بوده و رونويسي مي شود .

     3 ) ريبوز بوده و رونويسي نمي شود .                                4) دئوكسي ريبوز بوده و رونويسي نمي شود .

160- كدام آنتي كدون زير را مي توان در سلول ها يافت ؟

     1) AAC                          2) ACU                          3) AUC                            4) AUU

 

 

          سوالات ویژه داوطلبان مشغول به تحصیل در دوره پیش دانشگاهی                                                            ( زیست شناسی پیش دانشگاهی : فصل 1 )       

 

 

161- براي ساخت يك رشته پلي پپتيد با n‌ آمينو اسيد ،‌ريبوزوم چند بار روي mRNA حركت مي كند ؟

     1)                           2) n                                3)                           4)

162- RNA پليمراز III به كدام يك وصل مي شود ؟

     1) DNA دو رشته اي حلقوي                                        2) DNA دو رشته اي خطي

     3) DNA تك رشته اي خطي                                         4) DNA تك رشته اي حلقوي

163- كدام ، در مورد عامل پايان ترجمه درست نيست ؟

     1) جنس مونومر هاي آن آمينو اسيدي است .

     2) شناسايي رمز UAA را به عهده  دارد .

     3) در جايگاه A ريبوزوم جاي مي گيرد .

     4) پيوند بين آخرين tRNA موجود در جايگاه A و پلي پپتيد را مي شكند .

164- الگو برداري از ژن سازنده آنزيمِ تجزيه كننده اسيد هموجنتيسيك به عهده كدام است ؟

     1) هليكاز                                                                2) DNA پليمراز يوكاريوتي

     3) RNA پليمراز II                                                    4) RNA پليمراز I

165- «مهار كننده» در كجا و توسط كدام ژن ساخته مي شود ؟

     1) سيتوپلاسم ، تنظيمي و حلقوي                                                                            2) هسته ، ساختاري و حلقوي

     3) سيتوپلاسم ، ساختاري و خطي                                                                           4) هسته ، تنظيمي و خطي

166- در بين توالي هاي اگزون و اينترون ............. (جمله را کامل کنید)

     1) فقط دومي رو نويسي مي شود .                                    2) فقط قسمتي از رونوشت اولي ترجمه مي گردد .

     3) فقط اولي رونويسي مي شود .                                                                            4) فقط قسمتي از رونوشت دومي ترجمه مي گردد .

167- تنوع مونومرهاي كدام ، بيشتر است ؟

     1) اپراتور                           2) افزاينده                          3) عامل رونويسي                 4) رونوشت اينترون


 

168- كدام گزينه نادرست بيان شده است ؟

     1) محل برقراري پيوند پپتيدي درجايگاه A ريبوزوم است .

     2) عمل دوبازوي tRNA كمك به نگهداري اين مولكول درون ريبوزوم است .

     3) اتصال زير واحد بزرگ ريبوزوم در انتهاي مرحله آغاز ترجمه روي مي دهد .

     4) قند پنتوز در آنتي كدون و كدون باهم متفاوت است .

 

169- همه مولكول هاي tRNA ................. (جمله را کامل کنید)

     1) محصول فعاليت RNA پليمراز III هستند .

     2) در هسته ساخته مي شوند ولي در سيتوپلاسم فعالیت دارند .

     3) داراي بازوي آنتي كدونِ CCA مي باشند .

     4) در نوكلئوتيد آدنين دار انتهايي به آمينواسيد متصل مي شوند .

170- توانایی انجام كدام عمل بين هليكاز و RNA پليمراز مشترك می باشد ؟

     1) شكستن پيوند هاي هيدروژني                                                                            2) تشكيل پيوند هاي هيدروژني

     3) شكستن پيوند هاي فسفودي استر                                  4) تشكيل پيوند هاي فسفودي استر

 

 

          سوالات ویژه داوطلبان فارغ التحصیل                                                                                   ( زیست شناسی و آزمایشگاه 1 : دروس 1 تا 3)

 

 

161- اساس رده بندي جديد «لينه» برچه پايه اي است ؟

     1) سود و زيان براي آدمي        2) نوع و نحوه حركت            3) شباهت هاي ساختاري         4) روابط خويشاوندي نزديك

162- بيشتر وزن بدن آدمي از چه ماده آلي ساخته می شود ؟

     1) آب                              2) پروتئين                          3) سلولز                            4) چربي

163- آنزيم اسفنج ساز صنعتي را در چه اندامكي درون سلول مي توان يافت ؟

     1) ميتوكندري                      2) گلژي                           3) ليزوزوم                          4) پراكسي زوم

164- ریبوزوم موجود در آمیب نسبت به ریبوزوم موجود در باکتری چگونه است؟

     1) ساده
تر و کوچکتر              2) ساده
تر و بزرگتر                3) پیچیده
تر و بزرگتر              4) پیچیده
تر و کوچکتر

165- تبديل روزنامه هاي باطله به قند عمدتاً محتاج چه آنزيمي است ؟

     1) سلولاز                          2) آميلاز                           3) پروتئاز                          4) ليپاز

166) عملكرد پيلوس باكتري ها در چه موردي شبيه كپسول آنهاست ؟

     1) حركت روبه جلو در محیط   2) چسبيدن به سطوح مختلف    3) حفظ شكل سلول              4) فرآيند هم يوغي

167- بين دو سلول گياهي بالغ و مسن چند لايه ديواره سلولي وجود دارد ؟

     1) يك                              2) سه                               3) پنج                              4) شش

168- آنزيم هاي خاصي كه در سلول كبدي به تنظيم قند خون كمك مي كنند را در چه اندامكي مي توان يافت ؟

     1) شبكه آندوپلاسمي زبر         2) ليزوزوم                         3) ميتوكندري                      4) شبكه آندوپلاسمي صاف

169- بيشترين تركيب آلي در طبيعت را چه پلي ساكاريدی تشکیل می دهد ؟

     1) ساختاري جانوران             2) ذخيره اي جانوران             3) ذخيره اي گياهان               4) ساختاري گياهان

170- كدام گزينه درست بیان شده است ؟

     1) برخي آنزيم ها از جنس پروتئين نيستند .

     2) همه گياهان فاقد سانتريول هستند .

     3) در دستگاه غشاي دروني ، همه اجزا داراي غشاهاي به هم پيوسته اند .

            4) در هر دو لايه غشاي سلولي ، كربوهيدرات وجود دارد 

منبع سایت گزینه ۲              

+ نوشته شده در  پنجشنبه 1385/06/30ساعت 13:51  توسط مینا  | 

نمونه سوال زیست سال سوم

                                          نمونه سوال زیست سال سوم

 

 

۱- آنتی هیستامین
ها عمدتاً برای مقابله با ترشحات چه سلولی در بدن مصرف می
شوند؟

      1) لنفوسیت                                2) ماستوسیت                             3) مونوسیت                                4) پلاسموسیت

۲- نقش کدام یک در مبارزه علیه سرطان ریه از همه بیشتر است؟

      1) فاگوسیت                               2) لنفوسیت B                            3) ماستوسیت                             4) لنفوسیت T

۳- بیماری ایدز، .......... بوده و به ایمنی .................. آسیب فراوانتری می
رساند. ( جمله را کامل کنید )

      1) اکتسابی، هومورال                   2) ارثی، هومورال                        3) اکتسابی، سلولی                      4) ارثی، سلولی

۴- در ایجاد ایمنی خونی (هومورال) کدام یک نقش ندارند؟

      1) پرفورین                                  2) گاماگلوبولین                           3) پلاسموسیت                            4) لنفوسیت B خاطره

۵- ایمنی حاصل از واکسن و سرم به ترتیب چگونه است؟

      1) فعال، فعال                              2) فعال، غیرفعال                        3) غیرفعال، غیر فعال                  4) غیرفعال، فعال

۶- ترشح چه ماده
ای موجب تسهیل عمل فاگوسیتوز می
شود؟

      1) اینترفرون                               2) پرفورین                                  3) لیزوزیم                                   4) پادتن

۷- در بیماری هپاتیت B کدام سلول
ها، اینترفرون ترشح می
نمایند؟

      1) سلول کبدی غیر آلوده            2) لنفوسیت B آلوده                   3) سلول کبدی آلوده                   4) لنفوسیت B غیرآلوده

 

 

 

 

۸- در انعکاس زردپی زیر زانو چند نوع نورون دخالت دارند؟

      1) 1                                           2) 2                                           3) 3                                            4) 4

۹- اتصال تالاموس و هیپوتالاموس به قشر مخ بعهده چیست؟

      1) ساقه مغز                                2) بصل النخاع                            3) مخچه                                     4) دستگاه لیمبیک

۱۰- کدام جانور طناب
های عصبی بیشتری دارد؟

      1) پلاناریا                                    2) لاک پشت                               3) مورچه                                     4) هیدر

۱۱- گزینه درست کدامست؟

      1) همه آنتی ژنها آلرژن هستند                                                      2) همه آلرژن
ها آنتی ژن هستند  

      3) همه آنتی
ژنها پُلی ساکاریدی
اند                                                  4) همه آنتی ژنها پروتئینی
اند

۱۲- چه قسمتی از «مننژ» داری حفرات خونی می
باشد؟

      1) نرم شامه                                 2) عنکبوتیه                               3) سخت شامه                             4) هر سه قسمت حفره خونی دارند

۱۳- عامل بالا رفتن نمودار تغییر پتانسیل غشای نورون
ها چیست؟

      1) خروج ناگهانی                 2) ورود ناگهانی                   3) خروج ناگهانی                4) ورود ناگهانی

۱۴- عمده ریشه شکمی نخاع در واقع شامل ................ نورونهای .................. است. ( جمله را کامل کنید )

      1) آکسون، حسی                         2) دندریت، حسی                        3) آکسون، حرکتی                       4) دندریت، حرکتی

۱۵- کدام قسمت مغز، نورون حرکتی ندارد؟

      1) هیپوتالاموس                          2) تالاموس                                  3) بصل النخاع                            4) مخچه

۱۶- تحریک عصب سمپاتیک منجر به تمامی موارد زیر می
گردد، به جز ............ .

      1) تشدید حرکات دودی مری       2) کاهش ترشحات بزاق               3) تشدید ضربان قلب                   4) افزایش تعداد تنفس

۱۷- مجموع اعصاب مغزی نخاعی آدمی چندتاست؟

      1) 12                                         2) 31                                         3) 43                                         4) 86

۱۸- افراد دوربین و نزدیک بین به ترتیب چه نوع عینکی لازم دارند؟

      1) هر دو محدب                          2) هر دو مقعر                             3) محدب، مقعر                            4) مقعر، محدب


۱۹- منشا عنبیه و قرنیه در چشم بترتیب چیست؟

      1) صلبیه، مشیمیه                       2) شبکیه، صلبیه                        3) مشیمیه، صلبیه                       4) مشیمیه، شبکیه

۲۰- استخوان ......... به پرده صماخ متصل بوده و از طرف دیگر هم با استخوان ..................... مفصل می
شود. ( جمله را کامل کنید )

      1) چکشی، رکابی                         2) چکشی، سندانی                      3) رکابی، سندانی                        4) سندانی، چکشی

۲۱- کدام ، فاقد میلین است؟

      1) دندریت نورون حسی               2) آکسون نورون حسی                3) دندریت نورون حرکتی             4) آکسون نورون حرکتی

۲۲- گیرنده
های چه مزه
ای در آدمی به زبان کوچک نزدیکترند؟

      1) ترشی                                     2) شیرینی                                  3) شوری                                     4) تلخی

۲۳- در کدام بیماری، سلول
های مخروطی چشم آسیب می
بینند؟

      1) آستیگماتیسم                         2) کوررنگی                                 3) آب مروارید                             4) پیرچشمی

۲۴- گیرنده
های پوستی ............. در آدمی به سطح پوست نزدیکترند؟( جمله را کامل کنید )

      1) درد                                        2) فشار                                      3) سرما                                       4) لمس

۲۵- کدام مورد بین چشم
های جامی شکل و مرکب، مشترک است؟

      1) قرنیه                                      2) سلول
های تیره جام                 3) عدسی                                    4) سلول
های گیرنده نور

۲۶- دلیل تشخیص طعمه توسط مارزنگی در تاریکی مطلق چیست؟

      1) وجود گیرنده
های ماوراء بنفش                                                    2) قدرت پژواک سازی

      3) وجود گیرنده
های مادون قرمز                                                     4) قدرت درک میدان الکتریکی

۲۷- کدام بیماری در انسان، فصلی و عفونی است؟

      1) پارکینسون                             2) پولیومیلیت                             3) آلزایمر                                    4) مالتیپل اسکلروزیس

۲۸- کدام ماده به نخاع وصل نمی
شود
؟

                1) انکفالین               2) مورفین                3) کدئین  4) نیکوتین

 

منبع:سایت گزینه ۲

+ نوشته شده در  سه شنبه 1385/06/21ساعت 14:39  توسط مینا  | 

نکته های جالب

 

                                           نکته های جالب

خون دماغ

طبق آمار به طور تقريبي يك نفر از هر 10 نفر دست كم يكبار سابقه خونريزي شديد از بيني داشته است. خونريزي ممكن است جزئي و يا خيلي شديد باشد. بعد از خونريزي‌هاي قاعدگي، خونريزي بيني شايعترين خونريزي خودبخودي در انسان است كه به علت پارگي عروق مخاط بيني كه بدون محافظ مي‌باشد اتفاق مي‌افتد. شايعترين محل خونريزي در اطفال و بالغين جوان قسمت قدامي تيغه بيني است ( كه ناحيه كيسلباخ kisselbakh يا ليتل little ناميده مي‌شود). خونريزي اين ناحيه را مي‌توان به آساني كنترل نمود. مشكل‌ترين و پيچيده‌ترين محل خونريزي در قسمت خلفي – فوقاني جدار خارجي و تيغه‌ي وسط بيني در اشخاص مسن است.

شايعترين علت خونريزي بيني ضربه يا تروما است. ضربه‌هاي شديد باعث شكستگي استخوان بيني شده و ضربه‌هاي خفيف نظير دستكاري بيني با انگشت آسيب به ناحيه ليتل وارد آورده و سبب از بين رفتن موكوس محافظ آن ناحيه مي‌شود.
عوامل مهم در كنترل خونريزي‌هاي بيني عبارتند از: علت، محل خونريزي، نحوه معالجه آن.

عوامل موضعي:
 در ميان عوامل موضعي كه سبب خونريزي بيني مي‌شوند، مي‌توان از ضربه‌هاي وارده به صورت، واكنش التهابي تغييرشكل ساختماني، وجود جسم خارجي، تماس با مواد شيميايي سمي، مداخله جراحي و تومورهاي داخلي بيني نام برد. ضربه‌ي موضعي يكي از شايعترين علل خون دماغ است. وارد كردن لوله بيني- معدي (افزايش مداوم فشار هوايي بيني) دستكاري داخلي بيني و بازيابي جسم خارجي داخل بيني كه سبب پاسخ التهابي شديد شده است، همه مي‌توانند مسئول خونريزي بيني باشند عمل‌هاي جراحي داخلي بيني و شكستگي‌هاي استخوان بيني، ديواره سينوس‌هاي صورت- كاسه چشم و قاعده جمجمه هم مي‌تواند سبب خون دماغ شوند.

بد شكلي‌هاي ساختماني:
به شكل مادرزادي يا اكتسابي مي‌توانند سبب درگيري قسمت غضروفي يا استخواني تيغه‌ي بيني يا شاخك‌ها شوند. در اين حالت هواي دميده شده با سرعت و تلاطم بيشتري وارد بيني مي‌شود. اين مسئله سبب خشكي غشاي مخاطي- التهاب و دلمه بستن مي‌شود. برداشتن دلمه‌ها از طريق پاك كردن بيني يا با فشار وارد كردن هوا از راه بيني انسداد يافته عروق خوني سطحي را در معرض قرار مي‌دهد و موجب خونريزي مي‌شود.
سرطان‌هاي متعددي مي‌توانند با خونريزي‌هاي خودبخودي بيني تظاهر كنند يكي از عوامل خونريزي شديد بيني در پسران، آنژيوفيبروم است. اين تومور خوش خيم عروق كه از ناحيه بيني- حلقي منشاء مي‌گيرد ممكن است به صورت خودبخودي يا در پاسخ به ضربه خونريزي كند.

درمان كلي:

1- حفظ خونسردي
2- بيمار بايد بنشيند و بالاتنه‌ي خود را به جلو خم كند و دهان خود را باز نمايد او در اين حالت مي‌تواند خون را تف كرده و آن را قورت ندهد سرانجام بالاتنه بايد به حالت معمول در آيد.
تنها اگر به مدت 5 دقيقه قسمت جلوئي بيني را در سمت خونريزي به روي تيغه‌ي بيني با انگشت دست بفشاريم بسياري از خونريزي‌هاي بيني مهار مي‌شوند به بيماران گوشزد مي‌شود كه پنبه يا دستمال در بيني خود نگذارند. زيرا ممكن است هنگام در آوردن آنها دچار مشكل شوند و مخاط بيني بيشتر دچار آسيب شوند. اگر سابقه خونريزي شديد يا طولاني وجود دارد يا در حين معاينه بيمار دچار افت فشار خون ارتوستاتيك (كاهش فشار خون وضعيتي) مي‌شود. تعيين سطح هموگلوبين و هماتوكريت جهت تصميم‌گيري در مورد ضرورت تزريق خون به بيمار الزامي است.
3- كمپرس‌هاي سرد بايد پشت گردن و همچنين پشت بيني گذارده شود.
4- پايين آوردن فشار خون
5- قطع داروهاي ضد انعقادي

بيشتر اينجا

چرا رنگین کمان به صورت « کمان » دیده می شود ؟

اولین کسی که به طور جدی در باره این مسئله مطالعه کرد رنه دکارت بود . قبل از دکارت کسانی مانند قطب الدین شیرازی یا تيودوريك در این باره تحقیق کرده بودند . دکارت با توجه به قوانین شکست همزمان ولی به طور جداگانه از اسنل ( بنیان گذار اصلی قوانین شکست و بازتاب ) به شرح رنگین کمان پرداخت و در سال 1637 نتایج خود را منتشر کرد .
یکی از دوستان مطلبی در این باره نوشته بودن و چون مختصر است همون مطلب رو اینجا می گذارم.
اول از همه توجه كنيــد كـه قطـره هـاي آب در حـال سـقوط كروي شكل اند ، پس به سراغ نحوه برهــم كنـش يـك پرتـو نـور سـفيد ، بـا يـك كـره شـفاف مـي رويـم . اگر كمـي بـــا چگونگي شكل گيري رنگين كمان آشنا باشيد مي دانيــد كـه رنگين كمان اصلي را مجموعه پرتوهايي كه در مرز قطرهوا، دوبار شكسته و يك بــار بـاز تـابيده انـد، مـي سـازند و چـون ضريب شكست آب براي رنگهاي مختلف متفاوت است، نور سفيد در ضمن اين شكســت هـا بـه اجـزاي رنـگياش تجزيـه ميشود، اما نور خورشيد پيوسته است و در تمــام نقـاط رو بـه نور قطره با آن برخورد مي كند كه شرايط بازتاب و شكســت در هر يك از اين نقاط ، متفاوت است.

مثلا پرتو نوري كه راستاي آن از مركز قطره مي گذرد، بدون شكست وارد آن شده و در سوي ديگر باز تابيده مــي شـود و روي همان مسير ورودي بــه بـيرون بـر مـي گردد. بـه عبـارت ديگر پرتو به وسيله قطره 180 درجه تغيير جهت مي دهــد، در مقابل اگر پرتو نور مماس بر قطره به آن بتابد، مي توانيد ببينيد كه هنگام ورود به بيشـترين مـيزان ممكـن مـي شـكند و پرتـو خروجي با پرتو خروجــي بـا پرتـو ورودي زاويـه حـدود 165 درجه مي سازد، بررسي بيشتر نشان مي دهد كه در بين اين دو وضعيت حدي ، زاويه انحـراف زاويـه بيـن پرتـو خروجـي و ورودي از 180 درجه كاهش مي يابد بــه مقـدار كمينـه 138 درجه مي رسد و سپس دوباره تا 165 درجه بالا مــي رود، امـا چون در اطراف مقدار كمينه، تغيـير زاويـه كـم اسـت، بخـش بزرگي از نور فـرودي ، در حـول و حـوش ايـن زاويـه 138 درجه از قطره خارج مي شود. به عبــارت ديـگر ، شـدت نـور خروجي در تمام زوايا يكسان نيست و بيشتر نـور رنگينـي كـه از قطره بيرون مي رود، با جهت تابش خورشيد، زاويه حــدود 138 درجه يا معادل آن 42 درجه مي سازد. البته ايــن زاويـه، بستگي به رنگ پرتو دارد و بين 40 تا 42 درجه براي رنگهاي قرمز تا بنفش متفاوت است. بنابراين مي توان تصور كـرد كـه تنها در زواياي حــدود 42 درجـه ، پرتوهـاي رنـگي بـه طـور مؤثر از قطره خارج مي شوند.

حالا تصور شكل رنگين كمــان، كـار سـاده اي اسـت، فـرض كنيد در بعد از ظــهر ، خورشـيد در حـال تـابش و فضـا پـر از قطره هاي كروي آب است و شما هم پشت به خورشــيد و رو به شرق ايستاده ايد، در اين وضعيت نور رنــگي كـه بـه چشـم شما مي رسد، مجموعه نورهاي خـارج شـده از تمـام قطراتـي است كه خط واصل چشم شما و آنها با راستاي نور خورشيد، زاويه بين 40 و 42 درجه مي سازد.

مكان هندسي اين قطره ها مخروطي بــه رأس چشـم شماسـت كه نيم زاويه رأس آن حدود 42 درجه است. چيزي كه شما از رأس اين مخروطي مي بينيد مقطع آن است، يعني يك نوار دايره اي به پهناي زاويه اي بين 40 و 42 درجه كه رنگهاي قرمز تا بنفش را در خــود جـاي داده اسـت، البتـه
سطح افق، اين دايره را قطع مي كند و چون قطـرات آب تنـها در هـوا حضـور دارنـد، شـما تنـها كمـاني از يـــك دايــره را ميبينيد. اين كمان، وقتي پرتو خورشيد موازي با افـق اسـت، يعني هنگام غروب به بيشينه خــود مــي رسـد و بـه نيـم دايـره تبديل مي شود. البته در آســمان و مثـلا از درون هـواپيمـا در شرايط مساعد مي تـوان رنگيـن كمـان دايـره اي را هـم ديـد.

بيشتر اينجا

 آنطرف رنگين کمان کجاست؟

وقتي در طول بارندگي فقط يك رنگين كمان مي بينيم در واقع چند رنگين كمان وجود دارد؟ پاسخ اين سؤال آنطور كه فكر مي كنيد ساده نيست! وقتي نور وارد يك قطره آب مي شود، در داخل قطره بازتاب كرده، و آنچه به چشم ما باز مي تابد رنگين كمان را تشكيل مي دهد. هر قطره باران، نوري را كه واردش مي شود در تمام جهات ممكن بازتابانده و مي شكند. اولين بار كه نور با قطره برخورد مي كند، يك پرتو كسري از آن نور بازتاب مي كند و و بقية آن در طول قطره حركت مي كنند تا به پشت قطره از سمت داخل برخورد كنند. دوباره، مقداري از نور شكت خورده و مقداري بازتاب مي كند. در هر برخورد با سطح سطح داخلي قطره، مقداري از نور باز مي تابد و در قطره مي ماند، و باقيماندة آن خارج مي شود. بنابراين پرتو هاي نور مي توانند بعد از يك، دو، سه بازتاب داخلي يا بيشتر از قطره خارج شوند.

وقتي شما دو رنگين كمان مي بينيد، اولين يا اصلي ترين كمان در زاوية 42 درجه، با نور قرمز در بيرون و نور بنفش در داخل به طور واضح ديده مي شود. كماان دوم هميشه كم رنگ تر بوده و بواسطة بازتاب دوم با رنگهاي معكوس (بنفش در بيرون و قرمز در درون) در زاوية 51 تشكيل مي شود. اسحاق نيوتن يك معادله رياضي بر حسب اندازه زاوية رنگين كمانها بعد از بازتاب N اُمِ داخل قطره بدست آورد. او معتقد بود كه در بازتاب سوم نور كافي وجود ندارد كه در واقع شخص آنرا ببيند، از اينرو هرگز مسئله را براي 3=N حل نكرد. ادموند هالي، بعد از نامگذاري ستارة دنباله دار هالي، محاسبات را بر دوش گرفت و كشف كرد كه سومين رنگين كمان در زاوية 40 درجه و 20 ثانيه تشكيل مي شود، و شگفت زده شد. اين رنگين كمان نبايستي در مقابل خورشيد تشكيل شود بلكه دور تا دور خورشيد تشكيل مي شود! دو هزار سال بود كه بشر به اشتباه در طرف ديگر آسمان در جستجوي اين كمان بود.

دياليز

علاپم فردي كه كليه خود را از دست داده است:عرق فرد بوي ادرار ميدهد - رنگ پوست تيره ميشود و... .
مدت زمان دياليز در دنيا 16 ساعت است.
دستگاههاي دياليز:فرزينوس 8 بي و فرزينوس 8 سي.
موارد استفاده از عمل دياليز :خوردن سم -كسي كه در كما به سر ميبردو كسي كه كليه خود را از دست داده است.
عوارض استفاده از عمل دياليز :انباشتن اوره باعث خارش ميشود-عمل جنسي را مختل ميكند-در مايعات محدوديت ايجاد ميكند -باعث افزايش فشار وارد بر قلب ميشود-مشكلات ريوي ايجاد ميكند-درد استخوان بوجود مي آيد-محدوديت لبنيات و ميوه به
خصوص موز بوجود ميايد زيرا كه فسفر جاي كلسيم را مي گيرد.
انواع دياليز:
1- دياليز صفاقي: در زير شكم پرده صفاق وجود دارد با متصل كردن يك لوله به پرده صفاق روزانه يك ليتر مايع وارد بدن ميشود كه پس از چند ساعت مواد دفعي و زاپد توسط همان لوله از بدن خارج ميشود. اين نوع دياليز بايد در محيط استريل انجام گيرد و فرد نيز بايد انسان منظم و تميزي باشد تا از عوارض بعدي جلوگيري شود.

2-ديابيز به كمك دستگاه فرزينوس :ابتدا بايد با استفاده از يك جراحي كوچك سياهرگ بدن را به سرخرگ متصل كرد زيرا كه فشار درون سرخرگ براي انجام اين كار مناسب نيست و بعد سرخرگ را توسط سياهرگ به دستگاه متصل ميكنند و بعد از 45 روز عمل دياليز انجام ميگيرد .

 

آلومینیوم
خواص و كاربردهاي آلومينيوم
آلومينيوم فلزي بسيار سبك، چكش خوار است و به رنگ سفيد نقره اي است و چگالي آن تنها يك سوم مس يا فولادي است. آلومينيوم رساناي خوب گرما و الكتريسيته است، نور و گرماي تابشي را منعكس مي كند، غير مغناطيسي است . آن را مي توان با فلزات ديگر آبكاري كرد يا با رنگ، لاك و الكل، يا ورقه ي پلاستيك پوشانيد گرچه آلومينيوم را براي اندام هاي زنده غير سمي و بي اثر مي دانند اما تحقيقات نشان داده است كه در كساني كه مبتلا به آلزايمر هستند ميزان آلومينيوم مغز آن ها نسبت به افراد ديگر بالاتر است.

آهن زودتر زنگ مي زند يا آلومينيم؟
مي دانيم كه از اثرات نا مطلوب اكسيژن بر روي بسياري از مواد و عناصر پوسيدگي، فساد و زنگ زدن است.
در پاسخ به سوال فوق بايد گفت كه آلومينيم زودتر از آهن زنگ مي زند اما اين زنگ زدگي به رنگ بدنه ي خود آلومينيم است و پس از زنگ زدن لايه اي به عنوان عايق روي هسته ي آلومينيم را پوشانده و مانع از رسيدن اكسيژن به آن مي شود، در حالي كه آهن ديرتر از آلومينيم زنگ مي زند اما زنگ زدگي آن به صورت پوسته شدن است و رنگ نامطلوبي در برابر آهن دارد.
پس بنابر اين زنگ زدگي آلومينيم داراي اثرات مثبت و زنگ زدگي آهن اثري منفي و مخرب دارد و بايد در اين گونه موانع از انواع ضد زنگ ها استفاده كرد.

 

مبع:سایت ملاصدرا

+ نوشته شده در  سه شنبه 1385/04/27ساعت 23:38  توسط مینا  | 

+ نوشته شده در  شنبه 1385/04/24ساعت 23:59  توسط مینا  | 

نمونه سوال ادبیات

سوالات مشترک  ادبیات

 

1- معانی صحیح همه
ی واژه
های «تنزیه - نفیر - سلوک - خرق - تیه» به ترتیب کدام است؟

     1) تبجیل - نفرت - زهد - پوشش - کوه                         2) تقدیس - زاری - پیروی - نوآوری - دریا

     3) تسبیح - فریاد - رفتار - دریدن - صحرا                      4) تعظیم - تنهایی - روش - شکستن - کویر

 

2- معنی چند واژه در کمانک مقابل آن، نادرست آمده است؟

منظومه
ها (آثار ادبی)، زخمه (چنگ)، شرحه (پاره گوشتی که از درازا بریده باشند)، پرده (نغمه)، بیالاید (آلوده شود)، مدوّن (گردآوری)

     1) یک                             2) دو                               3) سه                              4) چهار

 

3- در متن:«رقّت قلب و عواطف انسانی پهلوانان که در ضمن حوادث ظهور می کند، در حوضه
ی حماسه می
گنجد. صولت خشم هیچگاه حصار بردباری پهلوان حماسه را نمی
شکند و منائت فطرت او را به خفّت و مذلّت فرو نمی
کشاند» چندغلط املایی هست؟

     1) یک                             2) دو                               3) سه                              4) چهار

 

4- در کدام گروه کلمه
ها واژه
ای غلط است؟

     1) شاهنامه
های منثور - توجیه و تفسیر - سیرت و صورت     2) قرایح و عواطف - تلقّی و برداشت - دریغ و مظایقه

     3) فضایل و مکارم - بطلان اعمال - تعدّی و تجاوز             4) حرص و آز - عفاف و عصمت - ستایش و ثنا

 

5- «اخبار رستم» اثر کیست؟

     1) آزاد سرو سیستانی           2) ابوطاهر طرسوسی            3) ابوالمؤید بلخی                4) مؤلفی ناشناس

 

6- جاهای خالی عبارت:« اگر بخواهیم مجموعه
ی عظیم و پربار ........ بیتی مثنوی معنوی را کوتاه و خلاصه کنیم، به ........ بیتی می رسیم که سرآغاز دفتر اول مولاناست» با کدام گزینه کامل می
شود؟

     1) بیست و شش هزار - هجده                                                                            2) بیست و یک هزار - بیست و یک

     3) سی و شش هزار - نوزده                                         4) هجده هزار - بیست و شش

 

7- در کدام گزینه «اسلوب معادله» به کار رفته است؟

     1) در غــم مـا روزهــا بـی
گـاه شـــد                           روزهــا بـا ســوزها همــراه شــد

     2) نـی حـدیـث راه پـر خــون می کند                           قصـه
های عـشـق مجـنون مـی
کند

     3) محرم این هوش جز بی هوش نیست                           مرزبان را مشتری جز گوش نیست

     4) آتـش عـشـق اسـت کانـدرنی فـتـاد                           جوشش عشق است کانـدر می فتاد

 

8- در همه
ی ابیات جز بیت ........... «تضاد» وجود دارد؟

     1) مـن به هـر جمـعیتی نالان شـدم                               جفت بدحالان و خوش حالان شدم

     2) در نیـابد حـــال پخته هیـچ خـام                              پـس سخـن کـوتاه بایـد والســلام

     3) همچو نی زهری و تریاقی که دید                               همـچو نی دمسـاز و مشتاقی که دید

     4) کـز نیــسـتان تا مـرا ببـریـده
انـد                              از نفـــیرم مـــرد و زن نالـیــده
انـد

 

 

9- در کدام بیت استعاره وجود دارد؟

     1) نی، حریف هـر که از یـاری بـرید                              پرده
هــایـش پرده
هــای مـــا دریــد

     2) کـز نیـســتان تا مـرا ببـریـده
انـد                              از نفـیـرم مـــرد و زن نـــالیــده
انـد

     3) هر کسی از ظن خود شد یار مـن                               از درون مــن نجــست اســرار مــن

     4) روزها گر رفت گو رو باک نیست                               تو بمان ای آن که چون تو پاک نیست

 

10- متن زیر کدام یک از ویژگی های حماسه را توضیح می دهد:

«این حوادث قهرمانی - که به منزله
ی تاریخ خیالی یک ملت است - در بستری از واقعیات جریان دارند. واقعیاتی که ویژگی
های اخلاقی، نظام اجتماعی، زندگی سیاسی و عقاید آن جامعه را در مسائل فکری و مذهبی در برمی
گیرد.»

     1) داستانی                        2) قهرمانی                        3) ملی                             4) خرق عادت

 

11- شاعر در کدام بیت به تفاوت ظرفیت وجودی افراد اشاره می
کند:

     1) همـچو نـی زهـری و تریاقی که دیـد                          همچو نی دمساز و مشتاقی که دید

     2) سیـنه خـواهم شرحـه شرحه از فـراق                         تا بـگــویم شــرح درد اشـــتیـاق

     3) تن ز جان و جان ز تن مستور نیسـت                          لیک کس رادید جان دسـتور نیست

     4) سر مـن از نــاله
ی مــن دور نیـسـت                          لیک چشم و گوش را آن نور نیست

 

12- کدام بیت با آیه
ی«اِنا لله و اِنا الیه راجعون» تناسب معنایی دارد؟

     1) مــن به هــر جمــعیتی نــالان شـدم                         جفت بدحالان و خوش حالان شدم

     2) هر کسی کاو دور ماند از اصل خویش                          باز جـوید روزگـار وصـل خـویـش

     3) در غـــم مـا روزهــا بــی
گـاه شـــد                         روزهــا با سوزهــا هــمــراه شــد

     4) هر کســی ازظــن خــود شـد یار من                         از درون مــن بجــست اســرار من

 

13- از بیت:«من خفته بدم به ناز درکتم عدم          حسن تو به دست خویش بیدارم کرد» کدام گزینه دریافت می
شود؟

     1) بی
خبری عاشق از عشق، پیش از عنایت معشوق به وی     2) نازپروردگی عاشق موجب بی
توجهی وی به معشوق است

     3) عاشق خود را در برابر عشق نیست و نابود می
پندارد      

  4) عشق موجب آگاهی و بیداری معشوق می
شود و خواب و آرامش او را می
گیرد

 

14- مفهوم آیه
ی:«تعزّ من تشاء و تذّل من تشاء» در کدام مصراع آمده است؟

     1) نتوان وصف تو گفتن که تو در فهم نگنجی                    2) همه درگاه تو جویم همه از فضل تو پویم

     3) تو نماینده
ی فضلی تو سزاوار ثنایی                             4) همه بیشی تو بکاهی همه کمی تو فزایی

 

15- دربیت:«هرکه جز ماهی ز آبش سیر شد            هر که بی روزی است روزش دیر شد» ماهی نماد کیست؟

     1) عاشق دروغین                2) معشوق راستین               3) معشوق دروغین               4) عاشق راستین

 

          سوالات ویژه داوطلبان مشغول به تحصیل در دوره پیش دانشگاهی          ( زبان و ادبیات فارسی 1 دوره پیش دانشگاهی – دروس 1 تا 3 )

 

16- معني درست كلمه هاي «نعت-دستور – مَلِك – كتم » كدام است ؟

     1) تفسير راهنما حكومت مرگ                             2) مقدمه اجازه فرشته پنهاني

     3) سرزنش فرمان خداوند نيستي                          4) ستايش وزير پادشاه پوشش

 

17- در متن : «همّت هاي ظالمانه و هميّت هاي جاهلانه اي كه موجب مي شود انسان نسبت به ملاحي و مناحي بي پروا شود ، جامعه را در ظلمات جهل و ضلال فرو مي برد و مردم را در بيغوله ي انحتاط سرگردان مي سازد » چند غلط املايي هست؟

     1) يك                             2) دو                               3) سه                              4) چهار

 

18- «انه ايد» سروده كيست ؟

     1) هومر                            2) ويرژيل                         3) گيل گمش                     4) ايلياد

 

19- كدام اثر ادبي از نظر نوع حماسه با ظفر نامه ي حمد ا... مستوفي در يك رديف قرار مي گيرد ؟

     1) انه ايد                          2) اديسه                           3) حمزه نامه                      4) ابومسلم نامه

 

 

20-در همه ي ابيات زير جز بيت ......... نوعی جناس وجود دارد ؟

     1) هر كسي كاو دور ماند از اصل خويش                          باز جويد روزگار وصــل خــويش

     2) نـي حــريف هـر كه از يـاري بـريـد                          پرده هــايش پرده هـاي مـا دريـد

     3) آتش است اين بانگ ناي و نيست باد                           هر كه اين آتـش ندارد نيـست بـاد

     4) همـچـوني زهــري و ترياقي كه ديـد                          همچو ني دمساز و مشتاقي كه ديـد

 

21- در كدام بيت آرايه ي مجاز و مراعات نظير وجود دارد ؟

     1) نتوان وصف تو گفتن كه تو در فهم نگنجي                    نتوان شبه تو گفتن كه تو در وهم نيايي

     2) تـن زجـان و جــان ز تـن مسـتور نيست                     ليك كـس را ديد جـان دسـتور نيـست

     3) لب و دندان سـنايي همه توحــيد تو گويد                    مگر از آتش دوزخ بودش روي رهـايي

     4) سيـنه خـواهـم شــرحه شـرحـه از فــراق                  تا بـگــويـــم شــرح درد اشـتــيـاق

 

22- فايده ي اصلی تقسيم بندي آثار ادبي بر اساس انواع ( محتوا و محدوده ي عاطفي ) اين است كه :

     1) به خوبي مي توان علل ضعف يا نيرو گرفتن يكي از انواع را در دوره اي خاص بررسي كرد .

     2) بهتر مي توان به نوع احساس و عاطفه ي شاعر و نويسنده در دوره اي خاص پي برد .

     3) مي توان قالب هاي شعري و ادبي رايج در دوره اي خاص را بررسي و تحليل كرد .

     4) مي توان بدون در نظر گرفتن شكل ظاهري شعر و نثر، درباره انگيزه هاي شاعر و نويسنده در خلق اثر ، پي برد .

 

23- «ما ز درياييم و دريا مي رويم                                     ما ز بالاييم و بالا مي رويم » با كدام بيت مناسبت دارد ؟

     1) بشـنو از نـي چـون حكـايت مـي كند                         از جــدايي هــا شــكايت مـي كنـد

     2) هر كسي كاو دور ماند از اصل خويش                          باز جــويد روزگــار وصـل خـويش

     3) هـر كـه جـز ماهي زآبــش سـير شـد                         هر كه بي روزي است روزش دير شد

     4) نـي حــديث راه پــرخــون مـي كنـد                        قصـه هـاي عـشــق مـجـنون مي كند

 

24- از بيت : «حسنت به ازل نظر چو در كارم كرد            بنمود جمال و عاشق زارم كرد» كدام گزينه دريافت نمي شود ؟

     1) عشق حقيقي ، فراتر از محدوده ي زمان است .

     2) زيبايي معشوق ، خالق عشق در وجود عاشق است .

     3) نخستين مرحله ی عشق ، با عنايت معشوق نسبت به عاشق شكل مي گيرد .

     4) معشوق با گريه و زاري عاشق ، نسبت به او عنايت مي ورزد .

 

25- كدام نوع ادبي در ادبيات گذشته ي سرزمين ما رونق چنداني نداشته است ؟

     1) حماسي                        2) تعليمي                         3) نمايشي                         4) غنايي

        سوالات ویژه داوطلبان فارغ التحصیل                                                                                                                     ( ادبیات فارسی 2 – دروس 1 تا 7 )

16- معاني صحيح همه ي واژه هاي «زه-چرخ-سهم-قليه» به ترتيب كدام است ؟

     1) ريسمان كمند بهره-اندك                                                                         2) آفرين-تير-پول-اندك

     3) كمان-آسمان-نصيب-غذا                                        4) احسنت-كمان-ترس-غذا

 

 

 

 

17- معني چند واژه در كمانك روبروي آن ، نادرست آمده است ؟

كت (كتف) ، ذرع (اندازه) ، لاور (دلاور) ، بادي (صحرا) ، غزا (جنگ) ، ترگ (نيزه)، گبر (خفتان)

     1) يك                             2) دو                               3) سه                              4) چهار

 

18- در متن : «با حال استيصال و قليان روحي گفت : او كه بچّه
ي قنداقي نيست كه طبيب ، حبوبات و بقولات را برايش غدقن كرده باشد » چند غلط املايي است ؟

     1) يك                             2) دو                               3) سه                              4) چهار

 

19- در كدام گروه كلمه ها غلط املایی هست ؟

     1) هله و هشدار سوفار تير خراب و غراضه                 2) نيرنگ و دغل غضنفر شجاع تپانچه و اسلحه

     3) تلألوء آب هزيمت و شكست سماق مكيدن              4) كج و معوج تنبوشه و لوله مضغ و بلع

 

20- « سالاري ها » اثر كيست ؟

     1) جمال زاده                     2) سيمين دانشور                3) جلال آل احمد               4) بزرگ علوي

 

21- كدام كتاب با ديگر كتاب ها از نظر نوع و سبك داستان نويسي تفاوت دارد ؟

     1) مجمع ديوانگان               2) روزگار سياه                   3) اسكندرنامه                    4) شهرناز

 

22- در كدام گزينه «كنايه» وجود ندارد؟

     1)‌ همه كار افتاده دست زن و بچه ها ، استغفر الله ، آدم را كفري مي كنند .

     2) تازنده بود دست بيخ گلويش گذاشتيد و او مجبور شد صدايش را بلند كند .

     3) مي خواهند دست روي دست بگذاريم و حتي جنازه اش را تشييع نكنيم

     4) اي والله زن داداش ، عجب روي ما را سفيد كردي

 

23- در همه
ي ابيات جز بيت ............ آرايه تشخيص و جناس وجود دارد ؟

     1) پريـد از رخ كــفر در هــند رنـگ                             تپيدنـد بـت خـانه هـا در فــرنگ

     2) چنان ديد بر روي دشـمن زخـشم                              كه شد ساخته كارش از زهر چـشم

     3) فلك باخت از سهم آن جنگ رنگ                             بود سهمگين جـنگ شير و پلــنگ

     4) نــهادنــد آوردگـــاهـي چـــنـان                             كه كم ديــده باشد زمــين و زمـان

 

24- جمله ي «هر كه آن
جا نشيند كه خواهد و مرادش بود ، چنانش كشند كه نخواهد و مرادش نبود » با كدام بيت قرابت معنايي دارد ؟

     1) ثـوابــت باشـــد اي داراي خـــرمـــن                      اگر رحمـي كنـي برخـوشـه چـيني

     2) آسـمان بـار امـانـت نتوانســت كـشــيد                     قرعه
ی كار به نـام من ديـوانه زدنـد

     3) بيستون بر سر راه است مباد از شـيـريـن                     خبري گفته و غمگين دل فرهاد كنيد

     4) بيا كه قصر امل سخت سست بنياد اسـت                      بيار بـاده كـه بنياد عـمر بر باد است

 

25- مفهوم كدام گزينه با ديگر گزينه ها تفاوت دارد ؟

     1) مجلس آراي بلا معارض شده بود                               2) نوك جمع را چيده و متكلم وحده شده بود .

     3) كبّاده
ي شعر و ادب مي كشيد و بسيار محظوظ شده بود .  4) همه گوش شده بودند و ايشان زبان

 

 

منبع:سایت گزینه ۲

+ نوشته شده در  شنبه 1385/04/24ساعت 23:37  توسط مینا  | 

پروفسور حسابي

 

پروفسور حسابي

سيد محمود حسابي در سال 1281 (ه.ش), از پدر و مادري تفرشي در تهران زاده شدند. پس از سپري نمودن چهار سال از دوران كودكي در تهران, به همراه خانواده (پدر, مادر, برادر) عازم شامات گرديدند. در هفت سالگي تحصيلات ابتدايي خود را در بيروت, با تنگدستي و مرارت هاي دور از وطن در مدرسه كشيش هاي فرانسوي آغاز كردند و همزمان, توسط مادر فداكار, متدين و فاضله خود (خانم گوهرشاد حسابي) , تحت آموزش تعليمات مذهبي و ادبيات فارسي قرار گرفتند.

استاد, قرآن كريم را حفظ و به آن اعتقادي ژرف داشتند. ديوان حافظ را نيز از برداشته و به بوستان و گلستان سعدي, شاهنامه فردوسي, مثنوي مولوي, منشات قائم مقام اشراف كامل داشتند.

شروع تحصيلات متوسطه ايشان مصادف با آغاز جنگ جهاني اول, و تعطيلي مدارس فرانسوي زبان بيروت بود. از اين رو, پس از دو سال تحصيل در منزل براي ادامه به كالج آمريكايي بيروت رفتند و در سن هفده سالگي ليسانس ادبيات, در سن نوزده سالگي, ليسانس بيولوژي و پس از آن مدرك مهندسي راه و ساختمان را اخذ نمودند. در آن زمان با نقشه كشي و راهسازي, به امرار معاش خانواده كمك مي كردند. استاد همچنين در رشته هاي پزشكي, رياضيات و ستاره شناسي به تحصيلات آكادميك پرداختند. شركت راهسازي فرانسوي كه استاد در آن مشغول به كار بودند, به پاس قدرداني از زحماتشان, ايشان را براي ادامه تحصيل به كشور فرانسه اعزام كرد و بدين ترتيب در سال1924 (م) به مدرسه عالي برق پاريس وارد و در سال 1925 (م) فارغ التحصيل شدند.

همزمان با تحصيل در رشته معدن, در راه آهن برقي فرانسه مشغول به كار گرديدند و پس از پايان تحصيل در اين رشته كار خود را در معادن آهن شمال فرانسه و معادن زغال سنگ ايالت "سار" آغاز كردند. سپس به دليل وجود روحيه علمي, به تحصيل و تحقيق, در دانشگاه سوربن, در رشته فيزيك پرداختند و در سال 1927 (م) در سن بيست و پنج سالگي دانشنامه دكتراي فيزيك خود را , با ارائه رساله اي تحت عنوان "حساسيت سلول هاي فتوالكتريك", با درجه عالي دريافت كردند. استاد با شعر و موسيقي سنتي ايران و موسيقي كلاسيك غرب به خوبي آشنايي داشتند وايشان در چند رشته ورزشي موفقيت هايي كسب نمودند كه از آن ميان مي توان به ديپلم نجات غريق در رشته شنا اشاره نمود.

پروفسور حسابي به دليل عشق به ميهن و با وجود امكان ادامه تحقيقات در خارج از كشور به ايران بازگشت و با ايمان و تعهد, به خدمتي خستگي ناپذير پرداخت تا جوانان ايراني را با علوم نوين آشنا سازد.

پايه گذاري علوم نوين و تاسيس دارالمعلمين و دانشسراي عالي, دانشكده هاي فني و علوم دانشگاه تهران, نگارش ده ها كتاب و جزوه و راه اندازي و پايه گذاري فيزيك و مهندسي نوين, ايشان را به نام پدر علم فيزيك و مهندسي نوين ايران در كشور معروف كرد.

حدود هفتاد سال خدمت علمي ايشان در گسترش علوم روز و واژه گزيني علمي در برابر هجوم لغات خارجي و نيز پايه گذاري مراكز آموزشي, پژوهشي, تخصصي, علمي و ..., از جمله اقدامات ارزشمند استاد به شمار مي رود كه براي نمونه به مواردي اشاره مي كنيم:

_ اولين نقشه برداري فني و تخصصي كشور (راه بندرلنگه به بوشهر)

_ اولين راهسازي مدرن و علمي ايران (راه تهران به شمشك)

_ پايه گذاري اولين مدارس عشايري كشور

_ پايه گذاري دارالمعلمين عالي

_ پايه گذاري دانشسراي عالي

_ ساخت اولين راديو در كشور

_ راه اندازي اولين آنتن فرستنده در كشور

_ راه اندازي اولين مركز زلزله شناسي كشور

_ راه اندازي اولين رآكتور اتمي سازمان انرژي اتمي كشور

_ راه اندازي اولين دستگاه راديولوژي در ايران

_ تعيين ساعت ايران

_ پايه گذاري اولين بيمارستان خصوصي در ايران, به نام بيمارستان "گوهرشاد"

_ شركت در پايه گذاري فرهنگستان ايران و ايجاد انجمن زبان فارسي

_تدوين اساسنامه طرح تاسيس دانشگاه تهران

_ پايه گذاري دانشكده فني دانشگاه تهران

_ پايه گذاري دانشكده علوم دانشگاه تهران

_ پايه گذاري شوراي عالي معارف

_ پايه گذاري مركز عدسي سازي اپتيك كاربردي در دانشكده علوم دانشگاه تهران

_ پايه گذاري بخش آكوستيك در دانشگاه و اندازه گيري فواصل گام هاي موسيقي ايراني به روش علمي

_ پايه گذاري و برنامه ريزي آموزش نوين ابتدايي و دبيرستاني

_ پايه گذاري موسسه ژئوفيزيك دانشگاه تهران

_ پايه گذاري مركز تحقيقات اتمي دانشگاه تهران

_ پايه گذاري اولين رصدخانه نوين در ايران

_ پايه گذاري مركز مدرن تعقيب ماهواره ها در شيراز

_ پايه گذاري مركز مخابرات اسدآباد همدان

_ پايه گذاري انجمن موسيقي ايران و مركز پژوهش هاي موسيقي

_ پايه گذاري كميته پژوهشي فضاي ايران

_ ايجاد اولين ايستگاه هواشناسي كشور (در ساختمان دانشسراي عالي در نگارستان دانشگاه تهران)

_ تدوين اساسنامه و تاسيس موسسه ملي ستاندارد

_ تدوين آيين نامه كارخانجات نساجي كشور و رساله چگونگي حمايت دولت در رشد اين صنعت

_ پايه گذاري واحد تحقيقاتي صنعتي سغدايي (پژوهش و صنعت در الكترونيك, فيزيك, فيزيك اپتيك, هوش مصنوعي)

_ راه اندازي اولين آسياب آبي توليد برق (ژنراتور) در كشور

_ ايجاد اولين كارگاه هاي تجربي در علوم كاربردي در ايران

_ ايجاد اولين آزمايشگاه علوم پايه در كشور

منبع:سایت هوپا

+ نوشته شده در  دوشنبه 1385/03/22ساعت 11:28  توسط مینا  | 

آزمون فیزیک و آزمایشگاه 2

                                   آزمون فیزیک و آزمایشگاه 2

 

1.جاهای خالی را با کلمات مناسب پر کنید.(2 نمره)

الف)شیب خط مماس بر نمودار مکان-زمان در هر نقطه معرف ..............درآن نقطه است.

ب)یکای هر کمیت برای آن که مورد توافق بین المللی قرار گیرد باید...........و...........باشد.

ج)نیرویی که از طرف یک میز بر جسم روی آن وارد می شود......................است.

د)شیشه یک جامد (بلورین-غیر بلورین)........ است زیرا مولکولها در آن طرح (منظم-نامنظم).....قرار دارند.

 

2.در یک خط تعریف نمایید:1.5( نمره)

الف)یک نیوتن                  ب)چگالی                          ج)گرمای نهان ویژه

 

3.توضیح دهید: (4 نمره)

الف)چرا برف روی قله کوهها دیر تر آب می شود؟

ب)قانون اول نیوتن

ج)نحوه محاسبه اندازه انبساط واقعی مایعات

د)اصل پاسکال

 

4.بردار های a وb مطابق شکل مفروضند.با رسم شکل ثابت کنید جمع برداری دارای خاصیت جابه جایی است؟(1 نمره)(بردار از چپ به راست و بردارa از پایین به سمت شمال شرقی)

 

 

5.آزمایشی طراحی کنید که با استفاده از آن بتوان ضریب اصطکاک جنبشی لاستیک ماشین و جاده را تخمین زد؟(با رابطه)(1.5 نمره)

 

 

مسائل(در حل مسائل g=10 m/s2 است.)

 

6.اتومبیلی در مسیری مستقیم با شتاب ثابت شروع به حرکت کرده و پس از 20 ثانیه سرعتش 36km/h می رسد.سپس با همین سرعت 5 دقیقه رانندگی می کند.پس از آن ترمز کرده در مدت 10 ثانیه متوقف می گردد.اگر در مدت ترمز کردن شتاب ثابت باشد:الف)نمودار سرعت زمان آن را در این ها رسم کنید؟ب)با تعیین مقدار شتاب نوع حرکت را به طور کامل در هر مرحله مشخص کنید؟(1.5 نمره)

 

 

7.گلوله ای به جرم 24 گرم با سرعت 500m/s وارد تنه درختی می شود.اگر گلوله 12 سانتیمتر در تنه درخت فرو رود نیروی متوسطی که تنه بر آن وارد می کند چه قدر است؟(1/5 نمره)

 

8.جسمی به جرم 0/5 کیلوگرم را با سرعت 10m/s به بالا پرتاب می کنیم.اگر مقاومت هوا ناچیز باشد جسم تا چه ارتفاعی بالا می رود؟(1 نمره)

 

9.مکعبی به جرم 2 کیلو گرم و ابعاد 5cm در 10 cm در 20 cm را از وجه بزرگتر آن روی زمین قرار می دهیم.فشاری که به سطح زیرین خود وارد می کند چه قدر است؟(1/5 نمره)

 

10.فشار هوا در قله کوهی که 2000 متر از سطح آزاد دریا بالاتر است،چند میلیمتر جیوه و چند پاسکال است؟(1/5 نمره)

 

11. در وان حمامی 200 کیلوگرم آب داغ 50 درجه سانتیگراد وارد کردیم.چند کیلو گرم آب سرد 10 درجه سانتیگراد باید به آن بیفزاییم تا دمای آب درون آن 30 درجه سانتیگراد شود؟(c ابرابر است با 4200j/kgc) 1/5 نمره)

 

12.یک سر میله فلزی با سطح مقطع 0/01 متر مربع را به مدت 2 ثانیه روی حرارت می گیریم. طوری که بین دو سر آن 25 درجه سانتیگراد اختلاف دما به وجود آید.الف)اگر ضریب طولی آن 1.25 در 10 به توان منفی 5 باشد و به طول آن 2/5  سانتیمتر اضافه شده باشد طول اولیه آن چقدر بوده است؟ب)در صورتی که رسانش گرمایی آن k=400j/smk باشد چه مقدارگرما بین دو سر آن شارش می کند؟(1/5نمره)

 

+ نوشته شده در  چهارشنبه 1385/03/17ساعت 11:30  توسط مینا  | 

نمونه سوالات زبان فارسی 2 ترم دوم

                       نمونه سوالات زبان فارسی 2 ترم دوم

بخش اول :دستور

۱.وقتی کاری در زمان گذشته پیش از کار دیگری انجام گیرد از چه زمانی استفاده می کنیم؟در جمله یک مثال بیان کنید؟۱ نمره 

۲.جمله مجهول را معلوم و جمله معلوم را مجهول کنید؟(۱.نمره)

آنها درس را خوانده بودند.         اسرار دل گفته شده است.(او)

 

۳.در عبارات ذیل متمم قیدی و متمم اجباری را نشان دهید.علت آن را بیان کنید.( ۱ نمره)

محمد به لباس خودد می نازد.               محمد با اتومبیل آمد.

 

۴.در عبارات ذیل یک حرف ربط همپایه ساز ،یک حرف ربط وابسته ساز و یک جمله هسته پیدا کنید؟( ۱ نمره)

دل ها نگران بود ، اما چشم ها گریان . مشکل بود که آنها از رود خانه بگذرند.

 

۵.ضمیر های تو ، او، ََ ت، َ ش،را به صورت مؤدبانه در چهار جمله ی جداگانه به کار ببرید. ( ۱ نمره)

 

۶.از بن ماضی و مضارع مصدرهای ذیل،صفت مشتق بسازید.(برای هر مورد ۲ صفت ذکر کنید.)(۱ نمره)

رفتن {                                 مردن{

۷.لفظ * قاب* را در سه جمله به کار ببرید که به ترتیب در جمله اول شناس،در جمله دوم نا شناس و در جمله سوم اسم جنس باشد، دلیل شناس بودن اسم را در جمله اول بنویسید.(۱ نمره)

 

۸. نوع اسم های زیر را از جهت ساخت بیان کنید.( ۱ نمره)

مهمان سرا:                  گوسفند:                               روزه:                       تکاپو:

 بخش دوم: املا و بیاموزیم

 

۱.تنوین  ٌ و  ٍ در چه جملاتی و قالب هایی دیده می شود؟ یک نمونه مثال بزنید.(۱ نمره)

۲.عبارت ذیل درست به کار رفته یا اشتباه ؟ توضیح دهید.( ۱ نمره)

برادرت آمد من آن را در کتابخانه دیدم.

 

۳.در ترکیبات ذیل دو مورد اشتباه است،آن را اصلاح کنید.(۱ نمره)

اسیر و غریب                   هاج و واج                      کشت سیفی                 سیاست گزاری

 

 

بخش سوم:نگارش

۱.چهار ویژگی زبان محاوره ای را بنویسید.(۱ نمره)

 

۲.در فرهنگ معین تلفظ کلمه را به چه طریقی نشان می دهند؟ علامت مد به چه منظوری در آن به کار میرود؟(۱ نمره)

۳.چهار ویژگی مقاله ها را بنویسید؟(۱ نمره)

 

۴.یادداشت برداری به چند شکل انجام می شود؟برروی هر برگ چند مطلب را می توان نوشت؟(۱ نمره)

 

۵.روش های عمومی و کلی تحقیق را نام ببرید؟( ۱نمره)

 

۶.هنگام مراجعه به منابع چه منابعی را باید انتخاب کنیم؟(۱ نمره)

 بخش چهارم: زبان شناسی

 

۱.دو فایده از فواید تمایز زبان از گفتار را بنویسید؟ ( ۱ نمره)

 

۲.تعداد واج ها ،صامت ها و مصوت های زبان فارسی را بیان کرده و بنویسید در زبان انگلیسی چند واج وجود دارد؟(۱ نمره)

 

۳.نقش اصلی ساخت واژه اشتقاقی و ساخت واژه ی تصریفی را بیان کنید؟(۱ نمره)

 

 

 

                                                                    ***همواره پیروز و سر بلند باشید***

+ نوشته شده در  پنجشنبه 1385/03/11ساعت 11:49  توسط مینا  | 

نمونه سوال زبان انگلیسی 2

نمونه سوال زبان انگلیسی 2

1.دیکته(3 نمره)

.we can not hold our bre-t- for more than one min-te. we will get into tro-bl- if we don’t know how to read .people cr-ed when they read Oliver Twist alt-o-gh they knew he wasn’t a real boy. The  holy prophet re- - ved God’s mess-ge at the age of 40. There are h-les on both sides of the moon . Monkeys do not work pu-zl-es only to get food. Ali b-rt his hand when he was playing with a ham-er. They have walls as tall as b - - lding.

2.با یکی از کلمات ارائه شده جملات زیر را کامل کنید.(2 کلمه اضافی است.)(4 نمره)

Find out – enough – looked for – unwelcome – mixed up – miner – last – different – creator – thumb

.The hiccups are as……………as a bad cold.-

.The one God is the ……………..of the whole universe.-

.I’m completely …………….I can’t answer your question.-

.They will soon ………….who has taken the money.-

.Doctors know the reason for ………….illnesses.-

.I’m going to buy a watch when I have …………..money.-

. A farmer works on the farm .A……..works under the ground.-

.Most of the hiccups ……………only a short time. -

3. با استفاده از دانش زبانی خود جاهای خالی را کامل کنید.(2 نمره)

.The Russian …………went round the moon in 1959.-

.”What is the ……………..of your country?” About  70 million.-

......................Don’t get off the bus while it is

.................A round piece of money made of metal is a -

4.گزینه صحیح را انتخاب کنید.(1 نمره)

.The teacher will (destroy – cross – explain – cure ) the lesson to us.-

.He works in a factory and (pays – makes – earns) a little money.-

i  tried  very hard factory and (pays-makes-erans) a little money.

.Ali studied very hard all afternoon .This is the (question – reason – problem – title) why he is tired.

 

+ نوشته شده در  سه شنبه 1385/03/09ساعت 12:45  توسط مینا  | 

بارم بندی کتاب فیزیک 2 نوبت دوم

           بارم بندی کتاب فیزیک 2 نوبت دوم

فصل اول ۱/۲۵
فصل دوم ۱/۷۵
فصل سوم ۲ نمره
فصل چهارم ۴ نمره
فصل پنجم ۵ نمره
فصل ششم ۶ نمره

+ نوشته شده در  یکشنبه 1385/03/07ساعت 11:25  توسط مینا  | 

بارم بندی کتاب شیمی 2 نوبت دوم

                                              بارم بندی  کتاب شیمی 2  نوبت دوم

بخش ۱ ۲ نمره
بخش ۲ ۲ نمره
بخش ۳ ۵ نمره
بخش ۴ ۸ نمره
بخش ۵ ۳ نمره

+ نوشته شده در  یکشنبه 1385/03/07ساعت 11:21  توسط مینا  | 

نمونه سوالات شیمی 2 فصل 4 مبحث (طول پیوند شعاع اتمی شعاع واندروالسی)

نمونه سوالات شیمی 2 فصل 4 مبحث (طول پیوند شعاع اتمی شعاع واندروالسی)

1.طول پیوند H---CH در مقایسه با طول پیوند H---Br..........و انرژی آن در مقایسه با انرژی پیوند H---Br .......... است.(سراسری ریاضی -84)

1)کم تر کم تر            2)بیش تر بیش تر                3)کم تر- بیش تر    4)بیش تر- کم تر

2.اگر طول پیوند های کواالانسی Cl---Cl و I---I به ترتیب برابر 198pm و 226pm باشد،تفاوت شعاع کواالانسی (اتمی) کلر و ید کدام است؟(سراسری تجربی-80)

1)33                     2)34                            3)66                        4)68

3.اگر طول پیوند کواالانسی A---Aبرابر 130 پیکومتر و شعاع واندوالانسی اتم A ،135 پیکومتر باشد،تفاوت شعاع های کووالانسی و وان دروالسی این اتم چند پیکو متر است؟(سراسری تجربی-70)

1)5                             2)10                                         3)70                         4)25

4.اگرrc   شعاع کوالانسی وrw  شعاع وان دروالسی اتم A وl   طول پیوند بین دو اتم Aباشد،کدام معادله درست است؟(سراسری ریاضی-70)

1.rw= 0.5 l           2)l=2 rc                 3)rw<rc                         4)l=rw- rc

5.در کدام عنصر شعاع وان در والسی مفهوم شعاع اتمی را دارد؟(آزاد تجربی-75)

1)فلوئور                 2)نئون                        3)منیزیم                      4)سدیم

6.طول پیوند Be---Brدر BeBr2برابر 203pm و طول پیوند Br---Br برابر 228pm   است. شعاع کوالانسی Be چقدر است؟(آزار ریاضی -80)

1)89 pm                   2)114 pm                 3)51/5pm           4)153/5 pm

+ نوشته شده در  یکشنبه 1385/03/07ساعت 11:15  توسط مینا  | 

نمونه سوال شیمی 2 فصل 5

                                                                                                                                          

1.نامCH(CH3)__C(CH3)2____CH5   __ CH­3     به روش آیو پاک کدام است؟(سراسری ریاضی-63) 

  1)3-اتیل -2-3 دی متیل بوتان          2)3،2-دی متیل -2- اتیل بوتان         

  3)3،3،2- تری متیل پنتان                      4)4،3،3- تری متیل پنتان

   

2.اگر در مولکول متان به جای اتم های هیدروژن گروه های متیل قرار بگیرند کدام ماده حاصل می شود؟(سراسری تجربی -۷۲ 1

۱)2-متیل بوتان      2)2-متیل پروپان           3)2،2-دی متیل بوتان      4)2،2-دی متیل پروپان 

  3.3-اتیل دی متیل هپتان دارای چند اتم کربت است؟(آزاد تجربی -76)

     1)11                            2)12                                        3)10                       4)9

 

 ۴.ترکیبات مختلف با فرمول مولکولی یکسان چه نامیده می شود؟(آزاد ریاضی-82

    1)پلیمر                           2)آلوتروپ                    3)ایزومر                  4)هم رده

۵.  کدام دسته از هیدرو کربن ها((پارافین)) نامیده می شود؟(آزاد پزشکی-75)                                                                              

 1)آلکان ها            2)سیکلو آلکان ها              3)آلکین ها               4)آلکن ها                                                                                                                                                                                                                                                                                                                                                               

+ نوشته شده در  شنبه 1385/03/06ساعت 16:13  توسط مینا  | 

نمونه سوال فيزيک 2 فصل 6

                              نمونه سوال فيزيک 2 فصل 6

1..ضریب انبساط طولی یک جسم جامد تقریبا چند برابر ضریب انبساط حجمی آن است؟

(سراسری ریاضی-82)

1)3                 2)یک سوم                        3)دو سوم               4)سه دوم

 

2.یک قطعه ی 500 گرمی از مس را که دمای آن 67 سانتیگراد است در ظرفی عایق حرارت

که حاوی 380 گرم آب در دمای 20 درجه سانتیگراد است می اندازیم.دمای تعادل چند درجه ی

سلسیوس می شود؟(گرمای ویژه آب و مس به ترتیب 4200 ژول بر کیلوگرم درجه کلوین و 380

ژول بر کیلو گرم در جه کلوین و اتلاف گرما ناچیز است.)(سراسری ریاضی-82)

1)23                2)24                              3)25                        4)28

 

3)اگر فشار گاز کاملی را 25 درصد افزایش داده و هم زمان دمای مطلق آن را 20 درصد کاهش دهیم

حجم گاز چگونه تغییر می کند؟(سراسری ریاضی -82)

1)36 درصد کاهش           2)40 درصد افزایش         3)60 درصد افزایش        4)64 درصد کاهش

 

4)یک قطعه ی فلز به جرم 90 گرمی را درون آب در داخل استوانه ای می اندازیم .قطعه ی فلز کاملا در

آب فرو می رو د و سطح آب درون استوانه به انداز 1/2 cm  بالا می آید. اگر سطح مقطع داخلی استوانه

10 سانتیمتر مربع باشد چگالی فلز چند گرم بر سانتی متر مکعب است؟(سراسری ریاضی-82)

1)5/5                            2)6                                          3)7/5                            4)8

 

5)چند گرم بخار آب 100 درجه را در 590 گرم آب 10 درجه ی سلسیوس وارد کنیم تا دمای تعادل

به 50 در جه ی سلسیوس برسد؟(سراسری تجربی -82)

1)35                            2)40                                     3)45                                   4)50

 

6)یکای ضریب انبساط سطحی جامد ها در SI    کدام است؟(سراسری تجربی-82)

1)بر کلوین           2)بر متر مربع       3)متر مربع بر کلوین                 4)کلوین برمتر مربع

+ نوشته شده در  پنجشنبه 1385/03/04ساعت 14:11  توسط مینا  | 

نمونه سوال زیست فصل 9

نمونه سوال زیست فصل 9

1.در فرد ایستاده نزدیک ترین عضله به ماهیچه ی توام کدام است؟(سراسری-82)

1)خیاطه                 2)دلتایی                3)ذوزنقه                       4)دو سر بازو

2.کدام عبارت صحیح است؟(سراسری-82)

1)کاهش فشار هوای زیر بال ها به صعود پرنده کمک می کند.

2)سرعت حرکت ماهی ها به کمک باله های سینه ای تنظیم میشود.

3)انقباض همزمان ماهیچه های دو طرف ستون مهره ها ماهی ها را به جلو می راند.

4)بالک باعث افزایش فشار هوا در بالای بال پرنده  هنگام صعود می شود.

3.دو ماهیچه ای که در یک سطح (پشتی یا شکمی) بدن انسان قرار دارند کدامند؟(سراسری-83)

1)توام سه سر بازو                                          2)چهار سر ران- ذوزنقه

3)سرینی دو سر بازو                                      4)خیاطه دو سر ران

4.کدام عبارت صحیح نیست؟(سراسری-83)

1)مفصل لولایی توسط کپسول رشته ای پوشانده می شود.

2)هر تارچه ماهیچه به طور مستقل توسط سارکولم احاطه شده است.

3)تارهای ماهیچه ها درون سیمایی از بافت پیوندی قرار دارند.

4)در اسکلت حشرات رشته های پلی ساکاریدی درون ماده ی پروتئینی قرار دارد.

5.باز شدن میوه ها که در اثر تغییر میزان رطوبت هوا صورت می گیرد و گل بعضی گیاهان هنگام روز باز و در

 شب بسته می شوند به ترتیب از کدام نوع حرکت های گیاهان می باشند؟(آزاد پزشکی-83)

1)فعال پیچشی غیر فعال                                2)غیر فعال فعال تنجشی

3)فعال پیچشی فعال پیچشی                          4)القایی غیر فعال

6. نوع کدام مفصل با مفاصل دیگر متفاوت است؟ (سراسری- 83)

1) بند های پا در مورچه                                        2) بازو و شانه ی انسان

3)نیم لگن و ران انسان                                         4)ران و درشت نی انسان

+ نوشته شده در  پنجشنبه 1385/03/04ساعت 14:11  توسط مینا  | 

نمونه سوال زیست

سوال                                                                                 (زیست ۱ فصل ۱تا ۳)

۱۶۱- اساس رده بندي جديد «لينه» برچه پايه اي است ؟

     1) سود و زيان براي آدمي        2) نوع و نحوه حركت            3) شباهت هاي ساختاري         4) روابط خويشاوندي نزديك

۱۶۲- بيشتر وزن بدن آدمي از چه ماده آلي ساخته می شود ؟

     1) آب                              2) پروتئين                          3) سلولز                            4) چربي

۱۶۳- آنزيم اسفنج ساز صنعتي را در چه اندامكي درون سلول مي توان يافت ؟

     1) ميتوكندري                      2) گلژي                           3) ليزوزوم                          4) پراكسي زوم

۱۶۴- تبديل روزنامه هاي باطله به قند عمدتاً محتاج چه آنزيمي است ؟

     1) سلولاز                          2) آميلاز                           3) پروتئاز                          4) ليپاز

۱۶۵) عملكرد پيلوس باكتري ها در چه موردي شبيه كپسول آنهاست ؟

     1) حركت روبه جلو در محیط   2) چسبيدن به سطوح مختلف    3) حفظ شكل سلول              4) فرآيند هم يوغي

۱۶۶- بين دو سلول گياهي بالغ و مسن چند لايه ديواره سلولي وجود دارد ؟

     1) يك                              2) سه                               3) پنج                              4) شش

۱۶۷- آنزيم هاي خاصي كه در سلول كبدي به تنظيم قند خون كمك مي كنند را در چه اندامكي مي توان يافت ؟

     1) شبكه آندوپلاسمي زبر         2) ليزوزوم                         3) ميتوكندري                      4) شبكه آندوپلاسمي صاف

۱۶۸- بيشترين تركيب آلي در طبيعت را چه پلي ساكاريدی تشکیل می دهد ؟

     1) ساختاري جانوران             2) ذخيره اي جانوران             3) ذخيره اي گياهان               4) ساختاري گياهان

۱۶۹- كدام گزينه درست بیان شده است ؟

     1) برخي آنزيم ها از جنس پروتئين نيستند .

     2) همه گياهان فاقد سانتريول هستند .

     3) در دستگاه غشاي دروني ، همه اجزا داراي غشاهاي به هم پيوسته اند .

     4) در هر دو لايه غشاي سلولي ، كربوهيدرات وجود دارد .

منبع:سایت گزینه ۲

 

 

+ نوشته شده در  سه شنبه 1385/03/02ساعت 9:49  توسط مینا  | 

نمونه سوال عربی

گروه‌هاي آزمايشي علوم رياضي، علوم تجربي

 

■■ عيّن الأصحّ والأدقّ فـى الترجمة أوالتعريب أو المفهوم للأسئلة (26 - 33):

 

26- «لمّا رجعت الأمّ قالت لهم: ألم تُراقبن حركات الفلاح حتّي تُخبرننـى هل يُهَدِّدُنا خطر؟ »

     1) هنوز مادر باز نگشته بود كه از آنها پرسيد: آيا مراقب حركات كشاورز بودند و آيا خطري ما را تهديد نمي‌كند؟

     2) هنگامي كه مادر بازگشت به آنها گفت: آيا مراقب حركات كشاورز نبوديد تا اينكه مرا خبر دهيد، آيا خطري ما را تهديد مي‌كند؟

     3) موقعي كه مادر برگشت يكي از آنها گفت: آيا مراقب حركات دهقان بوديد تا با خبر شويد كه خطري ما را تهديد مي‌كند؟

     4) وقتي كه مادر باز گشت از آنان پرسيد: براي چه مراقب كشاورز نبوديد تا مطلع شويد كه خطري تهديدمان مي‌كند؟

 

27- «هل تَعلمون أنّ الأعداء لا يُريدون لكم غَيرالضَياع والنَّهب والجرّ إلي التَبعيَّة و الأسْر؟!»

     1) آيا مي‌دانيد كه دشمنان براي شما جز نابودي، غارت و كشاندن به سوي وابستگي و اسارت را نمي‌‌خواهند؟!

     2) آيا مي‌دانيد كه دشمنان شما، برايتان فقط سردرگمي ، غارت، پيروي و اسارت از آنها را مي‌‌خواهند؟!

     3) آيا دانسته‌ايد كه خواسته تجاوزگران جز تباهي و غارت و دنباله‌ روي و اسارت نيست؟!

     4) آيا مي‌دانيد كه دشمن براي شما چيزي جز تباه شدن و از دست دادن ثروت و پيروي از آنها را نمي‌‌خواهند؟!

 

28- «هَل تَسمحين لـى بالذهاب ، إنّى لن أترك يَدها وَاللهُ خيرٌ حافظاً » 

     1) آيا اجازه مي‌دهي برويم، من هيچ وقت او را ترك نمي‌كنم، خداوند بهترين نگه دارنده است.

     2) آيا به من اجازه مي‌دهي كه بروم، به خدا سوگند كه او را خوب حفظ مي‌كنم و هرگز رهايش نمي‌كنم.

     3) آيا با رفتنم موافقت مي‌كني، من هرگز رهايت نخواهم كرد، اگرچه خداوند بهترين نگه دارنده است.

     4) آيا به من اجازه رفتن را مي‌دهي، من هرگز دست او را رها نخواهم كرد و خداوند بهترين حافظ است.

 

29- عيّن الخطأ :

     1) نُبارك طالباتٍ يجتهدن من أجل المستقبل = به دانش آموزانی که به خاطر آينده تلاش کرده اند تبريک می گوييم.

     2) رأيت حمامة تُغرّد فوقَ الشجرة = کبوتری را که بالای درخت آواز می خواند ديدم .

     3) أجَبنا عن أسئلةٍ قد رأيناها سابقاً = به سؤالاتی پاسخ داديم که قبلا آنها را ديده بوديم .

     4) نحن طلابٌ لم نتکاسل فـى دروسنا = ما دانش آموزانی هستيم که در درسهايمان تنبلی نکرده ايم.

 

30- «هنگامي که ماه پرتوهاي نقره فام خود را ظاهر کرد، منظره، زيبا و دلپسند گرديد»

    1) حينما أظهر القمر أشعّته الفِضّيَّة أصبح المنظر جميلاً رائِعاً.                            2) القمر عندما أظهر شعاعَه الفضىّ صار المنظر أجمل و أروع.

    3) لمّا ظهرت أشعة القمر الفِضّيَّة أصبح المنظر رائعاً جميلاً.                               4) بينما تظهر أشعة

القمر الفضىّ يُصبح المنظر جميلاً رائعاً.

 

31- «ما بايد علم را بجوييم و تنبلي نكنيم ، براي اينكه موفقيت ما در طلب علم است»

     1) علينا أنْ نطلب العلم و لا نَكسل لأنّ نجاحنا فـى طلب العلم .                         

    2) يجبُ علينا أنْ نبحث عن العلم و لا نَكسل لأنّ التوفيق فـى ‌العلم.

     3) لِنطلبْ نحن العلم و لا نَتكاسل لأنّ النجاح فـى مُطالبة العلم .    

      4) لابُدّ أنْ نطلب العلم و لا نكسل لأنّ توفيقنا فـى مُطالبة العلوم .

 

32- عيّن الصحيح:

     1) مردم از اشخاص خودخواه بيزارند = الناسُ لا يحبّون الراضى عن نفسه .

     2) خردمند كسي است كه از تجربه ديگران پند بگيرد = العاقل مَن يعتبر بتجربة الآخرين.

     3) تلاشگران براي تحقق اهداف تلاش مي‌كنند = المجتهدان يُحاولون أن يُحقّقوا أهدافهم .

     4) در دنيا خود را پيش از ديگران محاسبه كنيد = حاسِبوا الآخرينَ قَبل اَنفسكم فـى الدنيا.

 

33- عيّن الصحيح فـى المفهوم: «قَصِّر الآمال فـى الدنيا تَفُزْ           فَدليلُ العقل تقصير الأمَل»

     1) إنّ العاقل، عينه بصيرة و يده قصيرة.                   2) إنّما الفائز من قَصّر عقلَه لآماله فـى الدنيا.

     3) إنَّ تقصير الآمال نتيجة تقصير العقول.                 4) إنّ العاقل من كانت آماله قصيرة فـى الدنيا.

 

 

34- عیِّن الصّحیح فـى إعراب ما اُشیر إلیه بخطٍّ:

     «لاتَقُلْ أصلى و فصلى أبداً  إنّما أصل الفتی ماقَد حصل»

     1) منصوب تقدیراً – مجرورتقدیراً                            2)مرفوع تقدیراً – مرفوع تقدیراً

     3) منصوب محلاً – مرفوع محلاً                                    4) منصوب – مجرور محلاً

 

35- عیِّن الصحیح للفراغ: «شاهدتُ بناء . . . یَمُرُّ أمامَه نهرٌ . . .»

     1) عالٍ – جارٍ                  2) عالیاً – جاریاً               3) عالیاً – جارٍ                 4) عالـى – جارى

 

36- أیّ عبارة لایشتمل علی الترکیب الوصفى.

     1) السلامَ علی عبادِ الله الصالحینَ.                            2) لاتَعتمد علی النفس الأمّارة.

     3) ﴿مِن المؤمنین رجالٌ صدقوا ماعاهدوا اللهَ علیه﴾      4) الحسنُ و الحسینُ سَیِّدا شباب أهل الجَنَّةِ.

 

37- میّز الذى یختلف نوع إعرابه عن البقیه.

     1) الدنیا مزرعة الآخرة.                                          2) رأیت القاضى فـى المحکمة.

     3) هوالذى أرسل رَسُولَهُ بِالهُدی.                              4) ماعندکم ینفدُ و ماعنداللهِ باقٍ.

 

38- عیِّن الصحیح: «قام الطلّاب بواجباتهم فـى. . . و . . .»

    1) أربعة أیامٍ – ثلاث لیالٍ  2) أربع یومٍ – ثلاثة لیلةٍ   3) ثلاث أیامٍ – أربعة لیالٍ  4) ثلاثة یوم – أربع لیلةٍ

39- فـى أىّ عبارةِ یختلفُ نوعَ اعرابِ «الفاعل» ؟

ٍ

     1) ﴿إذا السّماءُ اِنْشَقَّتْ . . .﴾                                                                          2) ﴿تَبَّتْ یَدا أبی لَهب . . .﴾

     3) ﴿فَفَزِعَ مَن فـى السّماواتِ ومَن فـى الارض﴾             4) ﴿لقد خَلقنا الانسانَ فـى أحسنِ تقویمٍ﴾

40- أى عبارة لایکون فیه الإعراب الـمحلى.

     1) الجاهلُ مَن یَتبعُ الهَوی.                                                                            2) الراضى عَن عَملهِ لایَتقدَّمُ.

     3) هذانِ الصَّدیقان مسافرانِ إلی مشهد.                      4) ﴿رَبِّ اجعلْ هذاالبلدَ آمناً﴾

41- عيّن الصحيح للفراغ : « ... ، ... يُدافعون عن حقوق المظلومين»

     1) مُسلِمو ايرانَ                2) مُسلمون الايرانَ           3) الـمسلمى ايرانِ             4) مُسلمين ايرانَ

 

42- عيّن الجواب الذى لا يختلف فيه اعراب المضارع :

     1) ﴿ وَنَحن نُسبِّح و نُقدِّس لك                                            2) ﴿ ألا تُحبّون أن يَغفرالله لكم

     3) ﴿ لن تنالوا البرّ حتي تُنفقوا ممّا تُحبّون               4) ﴿ اللهمَّ أسألك أنْ تدخلنـى الجنة

43- عيّن الصحيح فـى إعراب الفعل المضارع:

     1) لايلعبون : مرفوع بالواو                                             2) حتي تنصرا : منصوب بالألف

     3) لَنْ تجلسنَ : منصوب بالفتحة                           4) تُطالعين : مرفوع بثبوت نون الاعراب

 

44- ما هو الخطأ عن الآیاتِ الکریمة؟

ِ

   1) ﴿وعلی الله فلیَتَوکّل المؤمنونَ﴾= مضارع مجزوم بلام الامر  

 2) ﴿إیَّاك نعبدُ و إیَّاك نستعین﴾ = مفعول به و محلاً منصوب

   3) ﴿ولِلّهِ غَیبُ السّماواتِ و الارضِ﴾ = خبر مفرد و مرفوع                        

   4) ﴿واللهُ یَبْسُطُ الرّزقَ  لِمَن یَشاء ﴾ = مفعول به و منصوب

 

عیّن التشکیل الصحیح (45 - 46):

45- «الافضل لنا مواجهة حقائق الحياة المرة بالتفاؤل»

     1) مُواجِهَةُ - حَقائقَ - الحَيَاةَ                   

   2) الأفْضَلُ - مُواجَهَةُ - حَقائقِ         

  3) الأفْضَلُ - حَقائقَ - المُرَّةَ                                             

     4) الحَيَاةَ - المرَّةِ - بالتَفاؤُلِ

 

46- «الهى نبهنـى لذكرك فـى أوقات الغفلة»

     1) اِلَهى - نَبَّهَنِى - أوْقاتِ   

 2) لِذِكْرِك - أوْقاتَ - الغَفْلَةِ                                   

    3) اِلَهى - نَبِّهْنِى - لِذِكْرِكَ 

  4) نَبَهَنِى - أوقاتِ - الغَفْلَةِ

 

 

منبع :سایت گزینه ۲

+ نوشته شده در  یکشنبه 1385/02/31ساعت 11:3  توسط مینا  | 

دوستان عزیز مدتی است که هر چی مطلب (بلند)می نویسم ثبت نمیشه اگه می دونید چرا بهم بگید خودم فکر می کنم شاید از کارته.!
+ نوشته شده در  شنبه 1385/02/16ساعت 14:34  توسط مینا  | 

روز معلم به تمامی معلمان عزیز مبارک باد.

+ نوشته شده در  سه شنبه 1385/02/12ساعت 14:57  توسط مینا  | 

نمونه سوال ریاضی 2(آنالیز ترکیبی)

                               نمونه سوال ریاضی 2(آنالیز ترکیبی)

1)تعداد اعداد طبیعی دو رقمی که مضرب 2 یا 5 باشند برابر است با: (سراسری ریاضی-67)

1)36                   2)63                         3)45                        4)54

2)با ارقام 0و1و2و3 پند عدد سه رقمی که تکرار ارقام در آن مجاز باشد می توان نوشت؟(سراسری انسانی-65)                                                                                                                                                         1)9                       2)24                      3)36                         4)48                                                                                                                      

3)چند عدد 5 رقمی یافت می شود که رقم اول آن 2و رقم آخر آن 4 باشد و هیچ یک از رقم های آن تکراری نباشد؟(سراسری ریاضی-57)

1)512                        2)504                          3)336                     4)216

4)با چهار عدد 0و9و6و5 چند عدد چهار رقمی (بدون تکرار) می توان ساخت؟(سراسری انسانی-68)

1)6                                  2)18                       3)24                     4)32

5)با چهار رقم 0و1و2و3 چند عدد سه رقمی بدون تکرار ارقام می توان نوشت؟(سراسری انسانی-63)

1)18                      2)24                         3)27                          4)64
+ نوشته شده در  سه شنبه 1385/02/12ساعت 14:14  توسط مینا  | 

نمونه سوال شیمی 2 ( پیوند داتیو) فصل 4

نمونه سوال شیمی 2 ( پیوند داتیو) فصل 4

1.در کدام یک از یون های زیر پیوند داتیو وجود ندارد؟(سراسری تجربی-62)

1)CO32-                        2)-NO3                             3)ClO-3                       4)SO2-3

2)در کدام یک از مولکول های زیر بیش ترین تعداد پیوند داتیو وجود دارد؟(سراسری ریاضی-70)

1)H3PO4                 2)HClO4                  3)HNO3               4)H2SO4

3)در کدام ترکیب دو پیوند داتیو تشکیل شده است؟(سراسری تجربی-71)

1)(NH4)2SO4               2)NH4ClO3               3)HN4NO3               4)(NH4)2HPO4

4.  در مورد پیوند H—F ،کدام مطلب نا درست است؟(سراسری-72)

1)داتیو است.                                              2)قطبی است.

3)اتم فلوئور در آن بار الکتریکی جزئی منفی دارد. 4)هر دو اتم در آن آرایش الکترونی گاز نجیب دارند.

5. کدام یک از عنصر های زیر در شرایط لازم تعداد پیوند داتیو بیش تری می دهد؟(آزاد ریاضی-80)

1)CL17            ­               2)S16                    3)P15                   4)N7

+ نوشته شده در  سه شنبه 1385/02/12ساعت 14:13  توسط مینا  | 

ماري كوري

ماري كوري

ماري كوري در سال 1867 در لهستان متولد شد. او، به عنوان يك كودك، مردم را با حافظة خارق‌العاده‌اش، شگفت‌زده مي‌كرد. او خواندن را وقتي تنها چهار سالش بود، آموخت.

پدرش يك پروفسور علوم بود. ابزارهايي كه او در جعبه‌اي شيشه‌اي نگهداري مي‌كرد، ماري را مجذوب مي‌كرد. ماري رؤياي دانشمند شدن را در سر مي‌پروراند، اما ميدانست اين كار آسان نخواهد بود. خانواده‌اش خيلي فقير شدند و در سن 18 سالگي، ماري يك معلم سرخانه شد و به خواهرش براي درس خواندن در پاريس كمك مالي مي‌كرد. بعدها خواهرش نيز او را در تحصيلش ياري كرد.

در آن روزها، براي دختران دانشگاهي در لهستان نبود. بنابراين، در سال 1891، ماري به دانشگاه سوربن در پاريس رفت. او به قدري فقير بود كه تنها نان و كره مي‌خورد و چاي مي‌نوشيدو لباسهاي كهنه‌اي را كه با خود از Warsaw آورده بود مي‌پوشيد.

هر روز تا 10 شب در كتابخانه درس مي‌خواند، پس از آن به اتاق سرد كوچكش مي‌رفت و تا ساعت 2 يا 3 صبح مطالعه مي‌كرد.

بعد از 4 سال در سوربن، ماري با Pierre Curie يك فيزيكدان مشهور، ازدواج كرد. (يك فيزيكدان يك دانشمند است كه طبيعت فيزيكي جهان را مطالعه مي‌كند ـ اشياء از چه ساخته شده‌اند و چرا اينطور رفتار مي‌كنند).

همراه با Curie به دنبال عناصر جديد گشتند. آنها سنگ معدن اورانيوم را گرفتند، آسياب كردند و جوشاندند. آنها، آنرا با اسيدها و ساير مواد شيميايي مورد آزمايش قرار دادند. سرانجام پس از چهار سال كار سخت ومصرف تن‌ها سنگ معدن، آنها يك دهم گرم راديوم خالص داشتند. آنها نخستين عنصر راديواكتيو را كشف كرده بودند.

در سال 1903، ماري، پير و يك دانشمند ديگر به نام Henry Becquerel، جايزه نوبل در فيزيك را به خاطر كشف راديوم و مطالعه راديواكتيويته بردند. ماري كوري اولين زني بود كه جايزه نوبل فيزيك را برد. بعدها، او يك جايزه نوبل ديگر در شيمي برد.

در زمان جنگ جهاني اول، ماري بر روي اشعه‌هاي X كار مي‌كرد. او باور داشت كه آنها مي‌توانند در درمان بيماريهايي مانند سرطان كمك كنند. او هيچ‌گاه سعي نكرد كه از كشفياتش براي مال‌اندوزي استفاده كند، زيرا معتقد به كمك به ديگران بود.

منبع :www.tavanir.org.ir

+ نوشته شده در  دوشنبه 1385/02/11ساعت 12:57  توسط مینا  | 

آشنايي با لايه هاي جو

آشنايي با لايه هاي جو

اتمسفر زمين را بر حسب چگونگي روند دما، اختلاف چگالي، تغييرات فشار، تداخل گازها و سرانجام ويژگيهاي الكتريكي به لايه‌هاي زير تقسيم كرده‌اند:

1- تروپوسفر (Troposphere)

2- استراتوسفر (Stratosphere)

3- مزوسفر (Mesosphere)

4- يونسفر (Ionosphere)

5- اگزوسفر (Exosphere)


1- تروپوسفر

تروپوسفر پايين ترين لايه اتمسفر است كه خود از لايه هاي كوچكتري تشكيل شده است.

وجه تمايز اين لايه با ديگر لايه هاي اتمسفر، تجمع تمامي بخار آب جو زمين در آن است؛ به همين دليل بسياري از پديده هاي جوي كه با رطوبت ارتباط دارند و عاملي تعيين كننده در وضعيت هوا به شمار مي آيند (از قبيل ابر، باران، برف، مه و رعد و برق) تنها در اين لايه رخ مي دهند.

منبع حرارتي لايه تروپوسفر انرژي تابشي سطح زمين است. از اين رو با افزايش ارتفاع با كاهش دما مواجه خواهيم بود.

ضخامت تروپوسفر، از شرايط حرارتي متفاوتي كه در عرضهاي جغرافيايي مختلف حاكم است تبعيت مي كند. اين ضخامت معمولاً از 17 تا 18 كيلومتر در استوا به 10 تا 11 كيلومتر در مناطق معتدل و 7 تا 8 كيلومتر در قطبها تغيير مي كند.

2- استراتوسفر

لايه استراتوسفر بر روي لايه تروپوسفر قرار دارد و ضخامت متوسط آن حدود 23 كيلومتر است. در 3 كيلومتر اول استراتوسفر، دماي هوا ثابت است اما در قسمتهاي بالاتر دماي هوا با ارتفاع افزايش مي يابد.

در استراتوسفر به ندرت ابر تشكيل مي شود و تنها در شرايط ويژه اي ممكن است ابرهاي كوهستاني به نام ابرهاي مرواريدي در ارتفاع 21 تا 29 كيلومتري از سطح زمين ظاهر شوند كه علت وجود آنها حركات موجي شكل هوا از سوي موانع مي باشد.

از ديگر ويژگيهاي مهم استراتوسفر وجود ازن در اين لايه است كه بخصوص در ارتفاع 20 تا 30 كيلومتري سطح زمين بر اثر واكنشهاي مختلف فتوشيميايي بدست مي آيد. مقدار ازن در اين لايه معمولاً روند فصلي دارد حداكثر آن در بهار و حداقل آن در پاييز مشاهده مي شود.

3- مزوسفر

در بالاي لايه گرم ازن لايه مزوسفر قرار دارد كه دما در آن متناسب با افزايش ارتفاع با آهنگ 3/0 سانتيگراد به ازاي هر 100 متر كاهش مي يابد به طوريكه دما در مرز فوقاني آن در ارتفاع 80 تا 90 كيلومتري به 80- درجه سانتيگراد مي رسد. و نتيجه اين دماي پايين انجماد بخار آب ناچيز موجود در اين لايه است كه باعث بوجود آمدن ابرهاي شب تاب مي شوند. اين ابرها درتابستان و در عرضهاي بالا ديده مي شوند. مزوسفر سردترين لايه اتمسفر تلقي مي شود.

4 - يونوسفر

از بخش فوقاني مزوسفر تا ارتفاع تقريبي 1000 كيلومتري اتمسفر زمين، بار الكتريكي شديدي حاكم است كه زاييده وجود يونها و الكترونهاي آزاد است. در حقيقت پرتوهاي پر انرژي خورشيد كه از فضاي خارج به طبقات بالايي اتمسفر وارد مي شوند باعث گسستگي پيوند يا يونيزاسيون مولكولها و اتمها مي شوند. بر اثر يونيزاسيون، الكترون آزاد مي شود و باقي مانده اتم به صورت يون در مي آيد؛ به همين علت اين لايه از جو را يونوسفر ناميده اند.

شدت يونيزاسيون در تمام ارتفاعات يونسفر يكسان نيست؛ بنابراين لايه هاي متفاوت با تراكم الكترون و يون متفاوت با ارتفاعات مجاور خود در يونسفر وجود دارد؛

اين لايه ها در ارتباطات راديويي اهميت بسياري دارند. اين لايه ها عبارتند از لايه هاي D,E,F .

5 - اگزوسفر

شرايط موجود در يونوسفر در اين لايه نيز حاكم است؛ بدين معني كه گازها در اين لايه همچنان قابليت هدايت الكتريكي خود را حفظ مي كنند. سرعت ذرات در اين لايه بسيار زياد است و در مواردي به 2/11 كيلومتر در ثانيه مي رسد.

اگزوسفر لايه گذار جو به فضاي كيهاني به شمار مي آيد كه بخش فوقاني آن را در ارتفاع بيش از سه هزار كيلومتري از سطح زمين برآورد كرده اند.

 

منبع:هوپا

+ نوشته شده در  یکشنبه 1385/02/10ساعت 15:20  توسط مینا  | 

مطالب قدیمی‌تر